ID: 903404867

View in Genome Browser
Species Human (GRCh38)
Location 1:23087903-23087925
Sequence ATGGAGAAGGAGGAACAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2202
Summary {0: 1, 1: 0, 2: 24, 3: 266, 4: 1911}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903404860_903404867 -8 Left 903404860 1:23087888-23087910 CCTCCTCCATGGGGGATGGAGAA 0: 1
1: 0
2: 0
3: 25
4: 198
Right 903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG 0: 1
1: 0
2: 24
3: 266
4: 1911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903404867 Original CRISPR ATGGAGAAGGAGGAACAGGA GGG Exonic
Too many off-targets to display for this crispr