ID: 903406336

View in Genome Browser
Species Human (GRCh38)
Location 1:23099927-23099949
Sequence GTGAGGGACCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 765}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903406336 Original CRISPR GTGAGGGACCAGAGGGAAGA GGG (reversed) Intronic
900313781 1:2047389-2047411 GAGAGGGCCCTGAGGGCAGAGGG - Intergenic
900693958 1:3998908-3998930 GTGAGGGAGGAGAGGGAACTGGG + Intergenic
900773679 1:4565550-4565572 GTGAGGACCCAGAGAGAAGATGG - Intergenic
900836075 1:5005158-5005180 GTGAGTGAGGAGTGGGAAGAAGG - Intergenic
901270064 1:7945395-7945417 GTGTGGGTCCAGAGAGCAGATGG - Intergenic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901784527 1:11616097-11616119 CTGAGGGAGCAGAGGGCAGTGGG - Intergenic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902276869 1:15346149-15346171 GTGAGGGACCTGAGGAACAAGGG - Intronic
902450125 1:16491419-16491441 GGGAGGGAGGAGAGAGAAGAGGG + Intergenic
902690229 1:18106525-18106547 GTGAGGTTCCAGAGGGCAGGAGG + Intergenic
902892241 1:19452725-19452747 GTGAGGGTCCAGTGGCAGGAGGG - Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
904026973 1:27510104-27510126 GTGAAAGCCCAGAGGGGAGAAGG - Intergenic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904745646 1:32709099-32709121 GAGAGGCACCAGAGGGCAGCAGG + Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904927344 1:34059371-34059393 ATGAGGGGGCTGAGGGAAGAGGG - Intronic
905264409 1:36741067-36741089 GCCAGGGGCTAGAGGGAAGAGGG - Intergenic
905336419 1:37247721-37247743 ATGAGGGACACGAGGGGAGAAGG + Intergenic
905867963 1:41386551-41386573 GTGAGAGAGAAGAGAGAAGACGG - Intergenic
906647616 1:47487048-47487070 GTGAGGGCCTATAAGGAAGAGGG - Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
908175087 1:61547528-61547550 GAGAGGGACCAGAGGTGAGCAGG + Intergenic
908472317 1:64456207-64456229 GTGGGAGACAAGAGGGCAGAGGG - Intergenic
908782276 1:67701234-67701256 GTGAGAGCCCAGAGGAAAGAGGG - Intergenic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
909352012 1:74665152-74665174 GTGAGGGCCCAGCAAGAAGATGG + Intronic
910188455 1:84571025-84571047 GTGAAGGACCAGAGAGTAGTAGG + Intronic
910566270 1:88646342-88646364 ATGAGGGAGCAGAGGGTACATGG + Intergenic
911127066 1:94350705-94350727 GGGAGGGATCAGAGGGCAAAAGG - Intergenic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
912518564 1:110230566-110230588 GGGAGGGAAGAGAGGGAAGGAGG - Intronic
912755437 1:112321265-112321287 GGAAGGGATAAGAGGGAAGAGGG - Intergenic
914202984 1:145503032-145503054 GTGAGGTAGCAAAAGGAAGAGGG - Intergenic
914236914 1:145820966-145820988 GTGAGGTAGCAAAAGGAAGAGGG - Intronic
914482106 1:148076183-148076205 GTGAGGTAGCAAAAGGAAGAGGG - Intergenic
914949209 1:152097220-152097242 GTGAGGGTACAGGGAGAAGATGG - Intergenic
915040683 1:152965946-152965968 GGGAGGGAGCTGAGGGAGGAGGG - Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915270153 1:154747979-154748001 GTGAGGGAGAATGGGGAAGAAGG - Intronic
916011236 1:160707798-160707820 GGGAGGGAGCAAAGGAAAGAAGG - Intronic
916313079 1:163418222-163418244 GGGAGGGAAGACAGGGAAGATGG + Intergenic
917605912 1:176629335-176629357 GTGAGTGACCACAGTGATGATGG + Intronic
917661636 1:177182154-177182176 GTGAGGGAGCTAAGGGAGGATGG - Intronic
918114252 1:181483388-181483410 TTCAGGGACCAGAGAGGAGAGGG - Intronic
918217028 1:182400700-182400722 GTGAGAGAGCAGTGGGCAGAAGG - Intergenic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
919118968 1:193315306-193315328 GTCAGGGAAGAGAAGGAAGAAGG - Intergenic
919207689 1:194437834-194437856 GTGAGAGCCCACAGGGAAGCAGG + Intergenic
919415056 1:197297685-197297707 GTGAGAGTCCACAGGGAAAAGGG + Intronic
919639752 1:200036417-200036439 GTGAGTGCTCAGAGGGAGGAGGG + Intronic
920110232 1:203582440-203582462 GTGATAGACCCTAGGGAAGAGGG + Intergenic
920202261 1:204266786-204266808 GTGAGGGATGAGAGGAGAGAGGG - Intronic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920544825 1:206807450-206807472 GTGAAGGCCCTGAGAGAAGAAGG - Intronic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
920977718 1:210801474-210801496 GTGCTGGTCCAGATGGAAGAGGG - Intronic
921564986 1:216706040-216706062 GTGGGGGACGAGGAGGAAGAGGG - Intronic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922333696 1:224600902-224600924 GTGAAGGCACAGAGGGAAGGTGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922749527 1:228064054-228064076 GTGAAGGACCACTGTGAAGATGG + Intergenic
922909900 1:229206575-229206597 CTCAGGGTCCAGAGAGAAGAGGG - Intergenic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923679011 1:236104102-236104124 GAGAGGGAGCAGATGGGAGACGG - Intergenic
923700289 1:236293722-236293744 ATGAGGACCCAGAGAGAAGATGG + Intergenic
924099354 1:240587906-240587928 GTAAGGGACTGGAGGGAATAGGG - Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924646717 1:245884619-245884641 GTGATTGACAAAAGGGAAGATGG + Intronic
1063248832 10:4252138-4252160 GTGAAGCATCTGAGGGAAGAGGG + Intergenic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1065825728 10:29568870-29568892 GGGAGGGAGCAGAGGAAGGAAGG + Intronic
1065973589 10:30823889-30823911 GTGGGAGAACAGAGGAAAGATGG - Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066072722 10:31836769-31836791 AGGAGGAACCAGAGGGCAGAGGG + Intronic
1066162132 10:32745464-32745486 GTGAGGGAGCAAAAGAAAGATGG + Intronic
1066547068 10:36511184-36511206 GTGAGTCCCCAGCGGGAAGACGG + Intergenic
1066696551 10:38084240-38084262 GTGAGTGACCTGAGTGAACAAGG + Intergenic
1067541846 10:47160593-47160615 CTGAGGGACCAGAGAGCACAAGG + Intergenic
1067703948 10:48593105-48593127 GGGAGGGCCCAGAGAGCAGAGGG - Intronic
1068106975 10:52630773-52630795 GTGAGGGCACAGTGGGAAGGCGG - Intergenic
1068451055 10:57189244-57189266 GTGAAGGATCAGGGGGAAGGTGG - Intergenic
1068529267 10:58166352-58166374 GCCAGGGACAGGAGGGAAGAGGG - Intergenic
1069656297 10:70091828-70091850 GCGAGGGACCAAAGGCAAGTCGG + Exonic
1069694904 10:70379539-70379561 ATGAGGGATAAGAAGGAAGAGGG + Intronic
1069884316 10:71614029-71614051 GTGAGGAACCAGAGCACAGAGGG + Intronic
1070916960 10:80161174-80161196 GTGAGGGCAGAGAGGGGAGAGGG - Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1071471635 10:85987659-85987681 GCCAAGGACCAGAGGGACGAAGG - Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071799996 10:89048467-89048489 GTGAGGGTGCAAAGAGAAGATGG + Intergenic
1072526539 10:96276655-96276677 GTGAAGAGCCAGAGGGAAAAAGG + Intergenic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073200874 10:101734257-101734279 GGGATGGAACAGAGGGGAGATGG + Intergenic
1073510433 10:104039418-104039440 GTGAGGGAGCAGTGAGAAGGTGG - Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073816190 10:107209973-107209995 GTGGGGGAGAAGAGGGGAGAGGG + Intergenic
1073930474 10:108568265-108568287 GTGGGGCAACAGAGTGAAGAAGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074268510 10:111929377-111929399 GTCAGGGACCAGAGGGCAAAAGG + Intergenic
1074402269 10:113151925-113151947 GTGAGGGACCAGAGTGCAGCAGG + Intronic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075017109 10:118917951-118917973 GAGAGGGGACAGAGGGAACAGGG + Intergenic
1075095652 10:119469011-119469033 GGGAGGGACCAGAGCGAGGGGGG + Intergenic
1075095660 10:119469031-119469053 GGGAGGGACCAGAGCGAGGGGGG + Intergenic
1075209708 10:120480812-120480834 GTGAGGGAGCAGAGGACAGTGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075845540 10:125542390-125542412 GTGAGGGAGAAGAGGGAAGCTGG - Intergenic
1075976885 10:126703850-126703872 GTCAGGGACCACTGGGAAGCTGG + Intergenic
1076236943 10:128870947-128870969 CTGAGGGACCACTGGGAGGAAGG - Intergenic
1076783412 10:132736917-132736939 CTGAGGGATCAGGGGGCAGAGGG - Intronic
1077109453 11:855635-855657 GTGAGGGAACGGAGGACAGATGG + Intronic
1077328154 11:1972506-1972528 GTGAGAGACCCGAGAGAAGGGGG - Intronic
1077338408 11:2015576-2015598 GGGAGGGAAGAGGGGGAAGACGG - Intergenic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1077664038 11:4092557-4092579 GTGGGGGAGCAGGGGTAAGAGGG - Exonic
1077921377 11:6644329-6644351 GTGAGGGACCATGGAGAAGTTGG - Intronic
1078106863 11:8363193-8363215 GCGAGGGAAGAGAGTGAAGAAGG + Intergenic
1078196058 11:9138027-9138049 GTGAGCTCCCAGAGGGAAAAGGG - Intronic
1078441653 11:11373208-11373230 GTGAGTGACCAGAGGGTAAGGGG + Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1080957134 11:37111122-37111144 GTGAGGGAGCAAAGGAAACAAGG - Intergenic
1081415398 11:42808952-42808974 GTGAGGAAAAAAAGGGAAGAGGG - Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081757605 11:45555809-45555831 TAGAGGGACAAGAGAGAAGATGG + Intergenic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1081854467 11:46295105-46295127 GCCAGGGACCTGAGGGAAGAGGG + Intronic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083159115 11:60843775-60843797 GTGAGGGACCATGAGGAAGGAGG + Intronic
1083381030 11:62268690-62268712 ATCAGAGACCAGAGGGCAGATGG - Intergenic
1083789908 11:64977771-64977793 ATGGGGGACCTGAGGCAAGAAGG - Intergenic
1084062485 11:66685473-66685495 GTGAGGAACCAGAAGGCAGAAGG + Exonic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084908634 11:72369403-72369425 GTGGGGGAGGAGGGGGAAGAGGG - Intronic
1085038789 11:73314863-73314885 ATCAGGGACCTGAGGGCAGAAGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085096409 11:73763994-73764016 GTGAGGGCACAGTGAGAAGATGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087978320 11:104578349-104578371 GTGAGGTTACAGAGAGAAGATGG + Intergenic
1088976872 11:114823514-114823536 GTGAAGGAACAAAGAGAAGAGGG - Intergenic
1089159794 11:116428678-116428700 GTGAGTGGCCAGGGAGAAGATGG + Intergenic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1089746892 11:120623899-120623921 GGGAGGGCCCAGAGAGAAGCAGG - Intronic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1090204083 11:124875359-124875381 TGGATGGACAAGAGGGAAGAAGG + Intronic
1090329102 11:125916182-125916204 GAGAGAGACCAGAGGGAAATCGG - Intronic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090924215 11:131235502-131235524 GGGAGGGACCAGCCGGAAGCAGG - Intergenic
1090940876 11:131387347-131387369 GCGATGGAGCAGAGTGAAGAGGG - Intronic
1202811133 11_KI270721v1_random:27686-27708 GTGAGAGACCCGAGAGAAGGGGG - Intergenic
1202821392 11_KI270721v1_random:70758-70780 GGGAGGGAAGAGGGGGAAGACGG - Intergenic
1091589555 12:1835126-1835148 GGGAGGGATCTGAGGGATGAAGG + Exonic
1091645602 12:2270098-2270120 GTCAGGGAACAGAGGGTGGAAGG + Intronic
1091664546 12:2409888-2409910 GTCAGGGAGGAGAGGGAAGTAGG + Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092016861 12:5166669-5166691 GTGAGGGACAAAAGGAAAGAAGG - Intergenic
1092367685 12:7890682-7890704 GTGAAAGACCAAAGGGAAGGGGG - Intronic
1092829449 12:12429675-12429697 GTGAGGGAAACGAGGGAAGTAGG - Intronic
1092883225 12:12904028-12904050 GGGAGAGATCAAAGGGAAGAGGG + Intronic
1092995164 12:13942949-13942971 CTGAGGGACCAGAGGGGTCAAGG - Intronic
1095237214 12:39812176-39812198 GTGAGGGCACAGATGAAAGATGG - Intronic
1095929941 12:47615101-47615123 GTGAGGGAACAATGAGAAGATGG - Intergenic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1096521968 12:52189590-52189612 GTGAGGGCCCACATGGAAGCAGG - Intronic
1096672818 12:53210496-53210518 GTGAGGGAGCTGAGTGAGGAGGG - Intergenic
1096673743 12:53215213-53215235 GGGAGTGGCCAGAGGAAAGAGGG + Intronic
1097160958 12:57046453-57046475 GTAGGGGCCCAGAGGGAACAGGG + Intronic
1097225778 12:57476149-57476171 GTCAGGGACCAGCGGGTAGCCGG - Exonic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1100764581 12:97849545-97849567 GTGAGGGACAAGAAAGAAAAAGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101584433 12:106072665-106072687 GGGAGGGAGAAGAGGGAGGAAGG - Intronic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1101910762 12:108858654-108858676 ATGAGGGACCACGGGGCAGAGGG + Intergenic
1102208610 12:111107620-111107642 GTGAGGGAGCAGAGGGTGCAGGG + Intronic
1102210719 12:111124997-111125019 ATGAGGGACCAGAGACAGGAGGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1103076412 12:117986327-117986349 GTGAGGGTACAGTGAGAAGATGG + Intergenic
1103670420 12:122610154-122610176 GTGCGGGTCCAGAGGGAAAGAGG - Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1103965751 12:124638313-124638335 GTGAGGACACAGTGGGAAGACGG + Intergenic
1105683317 13:22752122-22752144 GAGAGGGAGCAGGGAGAAGATGG - Intergenic
1105722916 13:23134665-23134687 GTGAGGGCACAGGTGGAAGATGG - Intergenic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107332039 13:39311766-39311788 GTGAGGGAGCCGAGGAAAGGGGG + Intergenic
1108199322 13:48027231-48027253 GGGATAGACCAGAGGAAAGAGGG + Intergenic
1109796732 13:67324420-67324442 GTGAGGGCGCAGGTGGAAGATGG + Intergenic
1110641517 13:77830182-77830204 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110641536 13:77830223-77830245 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1111144166 13:84158299-84158321 CTGAGGGACCTGAGTGAAGGAGG - Intergenic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1111893001 13:94106520-94106542 GTGAGGGAAGTGAGGGAGGATGG + Intronic
1112358722 13:98696933-98696955 GTGAGGACCTAGAGGGAAGGTGG + Intronic
1112978278 13:105348424-105348446 GTGAGGTTCCAGAGGCAAGGCGG - Intergenic
1113458737 13:110467169-110467191 ATGCAGGACCAGAGGAAAGATGG - Intronic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1116367474 14:44085713-44085735 GGGAGGGATGAGAGGGAGGAAGG - Intergenic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1118776574 14:68977861-68977883 GGGAGGGACCGGATGGAAGTGGG + Intronic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119660256 14:76446039-76446061 GGGAGGGAAGAGGGGGAAGATGG + Intronic
1119788299 14:77328645-77328667 ATGAGGAAACAGAGGGAAAATGG + Intronic
1119840416 14:77788515-77788537 GTGAGGGGCCAGCTGGAAGGAGG + Intergenic
1120698709 14:87674018-87674040 GTGTGGGACCAGGGGGCACATGG - Intergenic
1120824904 14:88946271-88946293 GAGAGGGAAGAGAGAGAAGAAGG + Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121280004 14:92691313-92691335 GTGAGGGCCCTGAGAGAAGGTGG - Intergenic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121574463 14:94972197-94972219 GTGAGAATGCAGAGGGAAGAAGG + Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122540295 14:102494165-102494187 GTGAGCGACCAAAGGGCTGAGGG + Intronic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1123173635 14:106397959-106397981 GTGAGCGAAAAGAGGGAGGACGG - Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1123626321 15:22229198-22229220 GTCAGGGGCCAGAGGGATGAGGG + Intergenic
1123773518 15:23554021-23554043 GTGAGGATACAGAGAGAAGATGG + Intergenic
1124439183 15:29674755-29674777 GGGAGGGAGGAGAGGGAGGAGGG + Intergenic
1124475457 15:30029398-30029420 GGGAAGGAGGAGAGGGAAGATGG - Intergenic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1124995712 15:34721471-34721493 GCAAGGGACCCGGGGGAAGAAGG - Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126757150 15:51935955-51935977 CTGAGGGAACATAGGGACGAGGG + Intronic
1127260766 15:57324507-57324529 GGGAGGGACCTGAGGGGGGAGGG - Intergenic
1127260786 15:57324558-57324580 GGGAGGGACCTGAGGGAGGGAGG - Intergenic
1127646532 15:60964471-60964493 GGGATGGAGCAGAGGGGAGAGGG + Intronic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1128143988 15:65322182-65322204 GAGAGGGAGCAGGGAGAAGAAGG - Intergenic
1128944437 15:71811397-71811419 GAAAGGGACCCGAGGGAAGGAGG + Intronic
1129148942 15:73675009-73675031 GTGTGGGACCAGGGGGTATATGG + Intergenic
1129333979 15:74841698-74841720 GTGAAGGGGCAGAGGGAAGGAGG - Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129463001 15:75709368-75709390 GTGAAGGAGCAGAGGGACCAGGG + Intronic
1129969404 15:79764201-79764223 GGGAAGGACCAGAAGGAGGAAGG + Intergenic
1129992039 15:79973865-79973887 GTGAGGGAAAAGAGGGAGGGAGG - Intergenic
1130162859 15:81418996-81419018 GTGAGGGTACAGTGAGAAGATGG + Intergenic
1130899662 15:88197828-88197850 GGGAAGAACCAGAGGGGAGACGG - Intronic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1131620979 15:94067806-94067828 GTAAGCTACCAGAGGGCAGATGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131988057 15:98064993-98065015 GTGAGGTACAAGAGGCCAGAGGG - Intergenic
1132289058 15:100686577-100686599 GTCAAGGCCCAGAGGGAAGCGGG + Intergenic
1132349699 15:101132238-101132260 ATGAGGAACCTGAGGGCAGAGGG - Intergenic
1132705966 16:1243615-1243637 GGGATGGGCCAGAGGGAGGAAGG - Intergenic
1132758082 16:1495679-1495701 GTGAGGCACCAGAGGGTGGCAGG - Intronic
1132880883 16:2161214-2161236 GGGAGGGGGCAGAGGGAAGCAGG - Intronic
1132923333 16:2411918-2411940 GTGGGGGAGCTGAGGGCAGAGGG - Intergenic
1133398010 16:5464031-5464053 GTGATGGACCAGCAGGAGGAGGG + Intergenic
1133487596 16:6235224-6235246 GTGAATGACCACATGGAAGAAGG - Intronic
1133866025 16:9644134-9644156 GTGGGGGTGCAGAGGAAAGAGGG + Intergenic
1134016946 16:10895434-10895456 GGAAGAGACCAGAGGGAGGAGGG - Intronic
1134167419 16:11941631-11941653 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1134225004 16:12382839-12382861 GAGAGGCACCAGAGAGAAGCAGG - Intronic
1134493279 16:14712065-14712087 GGGAGGGCCCAGACCGAAGAAGG + Intronic
1134498660 16:14751189-14751211 GGGAGGGCCCAGACCGAAGAAGG + Intronic
1134525214 16:14937819-14937841 GGGAGGGCCCAGACCGAAGAAGG + Intronic
1134547681 16:15123100-15123122 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1134581914 16:15377896-15377918 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1134712802 16:16336306-16336328 GGGAGGGCCCAGACCGAAGAAGG + Intergenic
1134720666 16:16379621-16379643 GGGAGGGCCCAGACCGAAGAAGG + Intronic
1134946761 16:18332264-18332286 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1134954025 16:18372387-18372409 GGGAGGGCCCAGACCGAAGAAGG - Intergenic
1135312850 16:21419281-21419303 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1135365773 16:21851561-21851583 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1135446041 16:22519601-22519623 GGGAGGGCCCAGACCGAAGAAGG + Intronic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1135880519 16:26251259-26251281 CTGAGGGAGCAGAGAAAAGAAGG - Intergenic
1135944660 16:26855274-26855296 TTGAGGAATCAGTGGGAAGATGG + Intergenic
1136152011 16:28357029-28357051 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1136168264 16:28470897-28470919 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1136194737 16:28644154-28644176 GGGAGGGCCCAGACCGAAGAAGG + Intronic
1136211069 16:28758253-28758275 GGGAGGGCCCAGACCGAAGAAGG + Intronic
1136255790 16:29038211-29038233 GGGAGGGCCCAGACCGAAGAAGG + Intergenic
1136309520 16:29398025-29398047 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1136322963 16:29499789-29499811 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1136437647 16:30239757-30239779 GGGAGGGCCCAGACCGAAGAAGG - Intronic
1137353880 16:47739174-47739196 GTGAGAGACAGGAGGGCAGAAGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137824480 16:51479404-51479426 GTCAGGGAGCAGAGGGCTGAAGG - Intergenic
1138436054 16:57000679-57000701 GTGAGGGACAACAGAGACGATGG + Intronic
1139484834 16:67249501-67249523 GGGAGAGACCAGACTGAAGAGGG - Intronic
1139543923 16:67639909-67639931 GTGAGGGAACAGAGAGGAGCTGG + Intergenic
1139857199 16:69990405-69990427 GGGAGGGCCCAGACCGAAGAAGG - Intergenic
1140125963 16:72119346-72119368 ATGAGGAACCTGAGGGAACAGGG + Exonic
1140207832 16:72948050-72948072 CTGAGGGACCAAAGGGCTGAGGG + Intronic
1140365469 16:74377516-74377538 GGGAGGGCCCAGACCGAAGAAGG + Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141458121 16:84158328-84158350 GTGAGGACCCAGGGAGAAGACGG - Intronic
1141926341 16:87172755-87172777 GTGAGGAATCTGAGGGTAGAAGG - Intronic
1141977654 16:87528173-87528195 GTCAGGGGCCGGAGGGAGGAGGG - Intergenic
1142168951 16:88610342-88610364 GTGAGCTTGCAGAGGGAAGAGGG + Intronic
1143021203 17:3917995-3918017 GGGAGGGAACGGAGGGAGGAAGG + Intergenic
1143441858 17:6981025-6981047 GGGAGGGAGGAGAGTGAAGAAGG - Intronic
1143622856 17:8090972-8090994 GGGAGGGAGGAGAGGGGAGAAGG + Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1146464757 17:33077587-33077609 GTGAGGGACCAGAGGTATTTTGG + Intronic
1146618452 17:34375861-34375883 GTGAGGGACCAGGGGAAAGAAGG + Intergenic
1146884199 17:36459999-36460021 GTGAGGCACCAGGGGTAGGAGGG + Intergenic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147664897 17:42140421-42140443 GTGGGAGACCTGAGGGACGATGG + Intronic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1148354716 17:46968199-46968221 GTAAGGAACCACAGGGAAGGAGG + Intronic
1148651359 17:49252392-49252414 GTCAGGGACCAAGGGGAGGAGGG - Intergenic
1148845881 17:50529525-50529547 GGGAGGGGCCAGAAGGGAGAGGG + Intronic
1149010484 17:51851417-51851439 GTGAGGAAACTGAGGCAAGATGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1150929881 17:69573098-69573120 GGGAGGGAGGGGAGGGAAGAGGG - Intergenic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151147247 17:72052839-72052861 ATGAGGTACCAGAGGGATAATGG + Intergenic
1151198805 17:72452673-72452695 CTGAGCAACCACAGGGAAGAAGG + Intergenic
1151293021 17:73164294-73164316 GTGAGGGAGCAAAGGGGAGCAGG - Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151887787 17:76933323-76933345 GGAAGGGAGCAGAGGGTAGAGGG - Intronic
1152375275 17:79915673-79915695 GTGAGGGAGCAGAGGGACGCAGG + Intergenic
1152427709 17:80227353-80227375 GTGAGTGACCACAGGGAATGGGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1153466528 18:5394573-5394595 GTGAGAGAACAGAGGAAAGGAGG + Intronic
1153473611 18:5472907-5472929 GTAAGGGACCAGAGAGGATAAGG - Intronic
1154118654 18:11633655-11633677 GGGAGGGCCCAGACCGAAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156432068 18:37085797-37085819 GAGAGGGAGGAGAGGGAAAAAGG - Intronic
1156779779 18:40837578-40837600 GCCAGGGACCAGATGGAACAGGG - Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157426143 18:47585944-47585966 GTGAGGGACCAGCGTGGAGTAGG - Intergenic
1157502017 18:48197671-48197693 GTGAGGGCACAGTGAGAAGATGG - Intronic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1159075960 18:63682460-63682482 GTGAGGGAGGAGAAGGACGAAGG - Intronic
1159359413 18:67381417-67381439 GTGAGGGGCCGCAGGGAAGCGGG + Intergenic
1159794344 18:72823427-72823449 GTGAGGGACCTAAGGGAAGAGGG + Intronic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1160118961 18:76109816-76109838 GTGAGGGCACAGTGGGAAAATGG - Intergenic
1160509839 18:79447232-79447254 GTCAGTGGGCAGAGGGAAGATGG - Intronic
1160965277 19:1744634-1744656 GGGAGGAAGCAGAGGGGAGATGG - Intergenic
1163241348 19:16065767-16065789 GGGAGGGGGCAGAGGGAAGCTGG + Intergenic
1163704359 19:18803724-18803746 GTGAGGGAGGAGGGGGGAGATGG + Intergenic
1163782469 19:19257698-19257720 GTAAGGGACCACAGGGAATGTGG + Exonic
1165051142 19:33142349-33142371 GGGAGGGAGCACAGGGATGAGGG + Intronic
1165725679 19:38110928-38110950 GTGATGGCCCAGAGGAAAGTCGG + Intronic
1165810311 19:38607967-38607989 GTCAGGGACCCCAGGGAGGATGG - Intronic
1165832663 19:38737048-38737070 GGGCGGGGCCAGTGGGAAGAGGG - Intronic
1165961186 19:39535753-39535775 GCGAGGAACCAGAGTGATGAAGG + Intergenic
1166737760 19:45096251-45096273 GTGAGGTGCGAGGGGGAAGATGG + Intronic
1166777815 19:45323262-45323284 GTGAGGGCCCAGGGGGCACAGGG - Intergenic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167603455 19:50467511-50467533 GTGGGGCAGCAGAGGGCAGAGGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167688754 19:50972502-50972524 GTGAAGGGCCAGAGGCCAGAGGG - Intergenic
1167699527 19:51034368-51034390 GAGAGGGACAGAAGGGAAGAGGG + Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1168103325 19:54152627-54152649 GTGAGGGGCCACAGGGAAGGGGG + Intronic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168411199 19:56141407-56141429 GGGAGGGACCAGAGGTTGGATGG + Intronic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925425639 2:3746973-3746995 GAGAGGGCCCTGAGGGAAGCAGG + Intronic
925924524 2:8660486-8660508 GTGACTGTCCACAGGGAAGAGGG + Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926227610 2:10979338-10979360 GTGAGGGAAGAGGGTGAAGATGG + Intergenic
926792080 2:16584305-16584327 ATGAGGGAACAGAGTGAAGCGGG - Intronic
927230836 2:20822938-20822960 GCGAGGAACCATAGAGAAGAAGG + Intronic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
927385395 2:22527114-22527136 GTGAGTGACCAGAGAGCATAAGG + Intergenic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928588374 2:32786581-32786603 TGGAGGGACCAGAGGCAAGGAGG - Intronic
929318739 2:40514126-40514148 GTGAGGGACAATAGGAAAAAAGG - Intronic
929537399 2:42792389-42792411 GTGAGGGCGCAGATGGAGGAGGG + Intronic
929563370 2:42969480-42969502 GTGAAGGTCCAAAGGGAAGGGGG + Intergenic
930037924 2:47099484-47099506 GTGAGGCACCAAAGGAATGAAGG + Intronic
931763796 2:65437198-65437220 GTGGGGGATGAGAGGGGAGAGGG - Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932129967 2:69178540-69178562 GGGAGGGGCCAGCGGCAAGAGGG + Intronic
932129976 2:69178560-69178582 GGGAGGGGCCAGGGGCAAGAGGG + Intronic
932218634 2:69983465-69983487 GGGAGGGACCAGAAGGCAGGAGG + Intergenic
932262315 2:70337093-70337115 ATGAGGGACCAGTGGGCTGATGG + Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
934577284 2:95410979-95411001 GGCAGGGCCCAGAGGGCAGAAGG - Exonic
934606460 2:95699173-95699195 GGGAGGGACCAGTGGGCTGAGGG - Intergenic
934639581 2:96019653-96019675 GGCAGGGCCCAGAGGGCAGAAGG - Intergenic
934794069 2:97085724-97085746 GGCAGGGCCCAGAGGGCAGAAGG + Exonic
936075360 2:109398243-109398265 GTGAGGGACTAGGGACAAGATGG - Intronic
936539863 2:113341301-113341323 GGGAGGGACCAGTGGGCTGAGGG - Intergenic
937869148 2:126775413-126775435 GTGCTGCACCAGAGGGACGAGGG + Intergenic
938399395 2:130976208-130976230 TTGAGGGATAAGAGGGAAAAGGG + Intronic
938692792 2:133807708-133807730 CTGAGGGACAAGAATGAAGAAGG - Intergenic
939682623 2:145157538-145157560 TGCAGGGAACAGAGGGAAGAGGG - Intergenic
941012221 2:160313407-160313429 GTGATAGACGACAGGGAAGAAGG - Intronic
941621605 2:167785254-167785276 GTGAGGGATCTGTGGGAAGATGG + Intergenic
941639272 2:167969929-167969951 GTGAGGGATAAGAGGAGAGAAGG - Intronic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
945557602 2:211298653-211298675 GTCAAGGACCAGAGGGGAGGAGG + Intergenic
946996469 2:225397914-225397936 GGGAGGGAGGAGAGGGAGGAAGG + Intergenic
947605055 2:231480901-231480923 GGGAGGGGCCAGAGGGAAGCTGG - Intronic
948138787 2:235657922-235657944 GTGAGGACACAGGGGGAAGACGG + Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948294508 2:236850592-236850614 GTGAGGGTCAACAGGGAAGGAGG - Intergenic
948502402 2:238405143-238405165 GACAGGGCCCATAGGGAAGAAGG + Intergenic
948530173 2:238599183-238599205 GAGAGGGACATGAGGGAAAAAGG + Intergenic
1168773073 20:428459-428481 GTGAGGGACTCAAGGTAAGAAGG - Intronic
1168833034 20:857758-857780 GTGAAGGACGTGAGGGGAGAGGG + Intergenic
1169259710 20:4127441-4127463 ATAAGGGAGCAGAGGGGAGATGG + Intronic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170409517 20:16073591-16073613 ATGAGGGATGAGAGAGAAGAAGG + Intergenic
1170788819 20:19491175-19491197 GTGAGGGACCTGGGGAAAGAAGG - Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1170888855 20:20363301-20363323 GAGAGGGACGAGAGGAGAGAGGG + Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1171416609 20:24985798-24985820 GTGAGGTCTCAGAAGGAAGAGGG + Intronic
1171417955 20:24996220-24996242 GTGAGGCACCAGGAGGCAGAGGG - Intergenic
1171956139 20:31465353-31465375 GTGAGGGACCTGAGGAGAGTGGG - Intergenic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172856654 20:38009471-38009493 GGGAAGGCCCAGAAGGAAGAAGG - Intronic
1172876828 20:38169561-38169583 GTGAGGGAGCATAGGGAGGGTGG + Intergenic
1173689534 20:44949498-44949520 GAGAGGAAGCAGAGGGAACATGG + Intronic
1174164571 20:48575695-48575717 GGGAGGGAGCAGAGGGGAGGAGG + Intergenic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1174887207 20:54348916-54348938 GGGAGGGACCAGAGAGTACAGGG + Intergenic
1175543344 20:59762055-59762077 GTCAGAGAGGAGAGGGAAGATGG + Intronic
1175650586 20:60718485-60718507 GTGAGGACCCAGGGAGAAGATGG + Intergenic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176513691 21:7767423-7767445 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1176896443 21:14383721-14383743 GTGCGGGGCCTGAGGGAAGTCGG + Intergenic
1177055924 21:16300806-16300828 GTGAGGGACCAAAGGCAGAAAGG - Intergenic
1178127702 21:29533319-29533341 GGGAGGGAAAAGAAGGAAGAAGG + Intronic
1178163368 21:29944216-29944238 GTAATAGACCAGATGGAAGATGG - Intergenic
1178639564 21:34335166-34335188 GAGACAGACCAGAAGGAAGATGG + Intergenic
1178647804 21:34397947-34397969 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179897996 21:44373917-44373939 GTGAGGGCTCAGAAGGAAGTGGG - Intronic
1180154267 21:45970618-45970640 GTGAGGGAGCAGCTGGAACAGGG - Intergenic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181339311 22:22165680-22165702 GTGAGGGGCAGAAGGGAAGAGGG + Intergenic
1181854436 22:25772089-25772111 GTGCAGGACCACAGCGAAGAGGG + Intronic
1181901050 22:26155980-26156002 GGGAGGGAGGAAAGGGAAGAAGG + Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182452212 22:30428395-30428417 ATGAGGGAACAGAAGGCAGAAGG - Intronic
1183017125 22:34997998-34998020 GGAAGAGCCCAGAGGGAAGATGG + Intergenic
1183118342 22:35709911-35709933 GTGAGGGCTCAGAGGAAACATGG - Intergenic
1183449794 22:37886846-37886868 GTGAGAGATCTGAGAGAAGAGGG + Intronic
1183912631 22:41091384-41091406 GTAAGGGACCAGTGGGAACCGGG - Intergenic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1183994252 22:41621050-41621072 GGGAGGGCCCACACGGAAGAGGG + Exonic
1184108344 22:42381499-42381521 GTCAGGGGCCAGTGGGCAGAGGG + Exonic
1184372894 22:44093927-44093949 GTGAGTGACCTGCAGGAAGAAGG + Exonic
1184509354 22:44924062-44924084 GGGAGGGAGGGGAGGGAAGAGGG + Intronic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
1185146381 22:49139077-49139099 GTAAGGGGGCAGAGGAAAGAAGG + Intergenic
949284375 3:2383730-2383752 GAGAGGGAGAAGAGAGAAGAGGG - Intronic
949948264 3:9207574-9207596 GGGAGGGAGGAGAAGGAAGAAGG + Intronic
950642451 3:14357131-14357153 GTAAGGGAGGAGAGGGAGGAAGG + Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
953150404 3:40319388-40319410 TTGAGGGACAAGAAGGGAGATGG - Intergenic
953197982 3:40751982-40752004 GGGAGAGATCAGAGGGAAGTGGG + Intergenic
953571906 3:44077947-44077969 GGGAGGGCCCAGAGCGAGGAGGG - Intergenic
953737483 3:45508844-45508866 GGGAGGGAGGAGAGGGAGGAAGG - Intronic
953965297 3:47300147-47300169 GTGAGGGATAAGAGTGGAGAGGG - Intronic
954092142 3:48293634-48293656 GTGGGAGAACAGAGGAAAGAAGG - Exonic
954097756 3:48343539-48343561 GCCAGGGCCCAGAGGGAAGGTGG + Intergenic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954697916 3:52437276-52437298 GTGATGGAAGAGAGAGAAGAGGG - Intronic
954709550 3:52498567-52498589 GTTAGGGCCCAGAAGGAAGCGGG - Intronic
954800413 3:53183840-53183862 GTGAGGGGCCAGTGGGCAGAGGG + Intronic
955813289 3:62814968-62814990 GAGAGGGACCAAAAAGAAGACGG - Intronic
956085088 3:65599442-65599464 GTGAGTGACTAGAAGGAAAAGGG - Intronic
956642923 3:71431588-71431610 GTGTGGGACCAGATGGACCAGGG - Intronic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
956687527 3:71844058-71844080 GTGAGAGAACAGAGGAAAGGAGG - Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
959143659 3:102517263-102517285 GTGAGGGGACAAAGAGAAGATGG + Intergenic
959594046 3:108109444-108109466 GTGAGGGATGACAGGGAGGAGGG - Intergenic
961014286 3:123455497-123455519 CTGAGGCACGAGGGGGAAGATGG - Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961424968 3:126837945-126837967 GTGAGGGATCACAGGACAGATGG - Intronic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
963015306 3:140818786-140818808 GTGTGGGCCCAGAGGTAAGGTGG + Intergenic
963503050 3:146152613-146152635 GTGAGGAATGAGAGTGAAGAGGG + Intronic
964298935 3:155266193-155266215 GTGAAGGTGCAGAGGGAAAAAGG + Intergenic
966133408 3:176670628-176670650 GTGGGGGACCACAGGGAAGTGGG - Intergenic
966501036 3:180639639-180639661 GAGAGGGACCTGAGGGATAAAGG + Intronic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967110552 3:186289707-186289729 GCCAGGGAACAAAGGGAAGATGG + Intronic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
967774910 3:193376319-193376341 GTGAGGGCACAGAGAAAAGATGG - Intronic
968574158 4:1357239-1357261 GTGAGGGTCCACAGAGCAGAGGG + Intronic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
968937063 4:3617112-3617134 GAAAGGGACGGGAGGGAAGAAGG - Intergenic
968937071 4:3617143-3617165 GAGAGGGATAGGAGGGAAGAAGG - Intergenic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
968937213 4:3617538-3617560 GGGAGGGGCAAGAAGGAAGAAGG - Intergenic
969373238 4:6747280-6747302 GAGAGAGGCGAGAGGGAAGAAGG - Intergenic
969417879 4:7073016-7073038 GAGAGGAACCAGAGTGGAGAAGG - Intergenic
969586461 4:8097005-8097027 GGGAGGGAGCAGGAGGAAGAAGG + Intronic
969868221 4:10089039-10089061 TTCAGAGCCCAGAGGGAAGAGGG - Intronic
970159349 4:13173329-13173351 GGGAGGAAACGGAGGGAAGAAGG + Intergenic
970589923 4:17550628-17550650 GAGAGGGAGGAGAGGAAAGAAGG + Intergenic
970930745 4:21508944-21508966 GTTAGGGAGCAGAAGCAAGAAGG - Intronic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
971184564 4:24361136-24361158 GGCAGGGACAAGAAGGAAGAAGG + Intergenic
971366824 4:25984355-25984377 GTGAGGGCACAGGGAGAAGAGGG - Intergenic
971903560 4:32695889-32695911 GTCAGGGACCAGAGGGAATGAGG + Intergenic
972833780 4:42844125-42844147 TTCAGGGACCAGATGGAAGAGGG - Intergenic
974514380 4:62890145-62890167 GTGTGGGGCAAGAGGAAAGAGGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976856399 4:89609830-89609852 GTGAGTGACCAGAGGAGAAAGGG + Intergenic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
977638587 4:99329535-99329557 GTGAGGATACAGAGGGAAGGTGG + Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
979831921 4:125315127-125315149 GTGAGGGACCAGGCGGGAGGTGG + Intergenic
980441715 4:132856435-132856457 GTGAGGCACAAGGGGGAAAAGGG + Intergenic
981161389 4:141503244-141503266 GTGAGGGCCCAGAAAGAAGGTGG + Intergenic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
982688576 4:158523003-158523025 GCGATGGAGCAGAGGGAAGGAGG - Intronic
982695828 4:158599269-158599291 GTGAGGGACCAGGAAGAGGAGGG - Intronic
982964047 4:161879577-161879599 GTGTGGGACAAGAGTGAGGAAGG - Intronic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984256965 4:177400869-177400891 GGGAGGGACTGAAGGGAAGATGG - Intergenic
984455163 4:179957370-179957392 ATGAGGAACCTGAGGGAAGAGGG + Intergenic
985137484 4:186801781-186801803 AGGAGGGTCCAGAGGGAAGTTGG + Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985748550 5:1661498-1661520 GGGAGGGACCACAGGGATGCTGG + Intergenic
986127183 5:4893998-4894020 GTGTGGCACAAGAGGAAAGAGGG + Intergenic
986212821 5:5690188-5690210 GTGAGGGAAGTGAGGGAAGCAGG - Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
987878336 5:23710274-23710296 GTGAGGGGACAGAGCCAAGATGG + Intergenic
988297913 5:29390448-29390470 GTGAGGGAGCAAAAGGGAGAGGG - Intergenic
988402649 5:30781384-30781406 GTGGGGGACCAGGGGCAGGATGG + Intergenic
988427170 5:31077137-31077159 GTGAGGAACCAGAGCCAAGTCGG - Intergenic
988634954 5:32972898-32972920 GTGAGGGGCCAGAGACAAGAAGG - Intergenic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
990205981 5:53430176-53430198 ATGAGGGGCCAGAGGCAGGAGGG - Intergenic
990691968 5:58374199-58374221 GTCCAGGACCAGATGGAAGATGG - Intergenic
992403478 5:76432932-76432954 GTGAGGAAGCTGAGGGAAGGAGG - Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993322559 5:86490658-86490680 GTGAGGGAGCAGAGGAAGGATGG - Intergenic
994222859 5:97216597-97216619 GTCAGTGACCAGGGAGAAGAGGG - Intergenic
995164080 5:109016963-109016985 GTGAGGACACAGTGGGAAGAAGG + Intronic
995243177 5:109908355-109908377 GATAGGCAGCAGAGGGAAGATGG - Intergenic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
996650103 5:125865404-125865426 GTGAGGGAGCTGAAGAAAGAAGG + Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
998041398 5:138952984-138953006 GTGAGGCCCCAGAGAAAAGAGGG + Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
1000685363 5:164242463-164242485 GCCAGGGACCAGGGGGAAGGAGG + Intergenic
1001004745 5:168040178-168040200 GTGAGGGACTAGAAGTAGGAAGG + Intronic
1001084188 5:168688413-168688435 GAGAGGGAGGAGAGGGATGAGGG - Intronic
1001548887 5:172587673-172587695 GGGAGGGACCAGAGGAGACAGGG - Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002453627 5:179333085-179333107 GTGAGAGACCCGAGAGCAGAGGG + Intronic
1002573191 5:180155691-180155713 GTAAGGGACAGGATGGAAGACGG - Intronic
1002804773 6:562093-562115 GTGAAGGGTCACAGGGAAGAAGG + Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003261532 6:4521133-4521155 CTGAGGGAGCCGAGGGAAGTGGG - Intergenic
1003443480 6:6164668-6164690 GGAAGGGACAAGAGGGAAAAAGG - Intronic
1003569987 6:7249453-7249475 GTAAATGACCAGAGGAAAGATGG + Exonic
1003593022 6:7451649-7451671 GCCAGGGACTAGAGGGAAGAGGG + Intergenic
1004527639 6:16424253-16424275 TCAAGGGACGAGAGGGAAGAAGG + Intronic
1004816450 6:19316286-19316308 GTGAGGATACAGAGAGAAGACGG + Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005562670 6:27056670-27056692 GGGAGGTACCAGAGGGTGGAGGG - Intergenic
1006092675 6:31637220-31637242 GAGAAGGACCTAAGGGAAGAAGG - Exonic
1006255574 6:32829657-32829679 GGGAGGGCCCAGTGGGAGGAGGG + Intronic
1006283829 6:33078133-33078155 GTGGGGGAGCAGAGAGCAGAAGG + Intronic
1006441177 6:34054617-34054639 GAGAGGGACAGGAGGGGAGAAGG - Intronic
1006474327 6:34245012-34245034 GTGAGGGCACAGGTGGAAGATGG - Exonic
1006722764 6:36169354-36169376 GAGAGGAAGCAGAGGAAAGATGG - Intergenic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1007018198 6:38490723-38490745 GTCAGTGAGAAGAGGGAAGAAGG + Intronic
1007103417 6:39267268-39267290 GTGATGGCCCAGAGGGAAGGTGG - Intergenic
1007413528 6:41678846-41678868 GTGAGGGACCAGACTGACAAGGG - Intergenic
1010471088 6:76229428-76229450 GTGAGGGACCAAAGGGCCTAAGG + Intergenic
1010738713 6:79472806-79472828 GTGAGGGGCCAGAGAAAACAAGG - Intergenic
1011372802 6:86656694-86656716 GTGGGGGATGAGAGGGAAGTGGG + Intergenic
1011710012 6:90043515-90043537 GTGAGGGAGGAGAGAGAGGAAGG - Intronic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012167305 6:95973387-95973409 ATGAGTTGCCAGAGGGAAGAAGG + Intergenic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013373973 6:109496323-109496345 GCGAGGGACCTGAGGCAAGCAGG - Intronic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1013724741 6:113080133-113080155 GGGAGGGAAGAGAGAGAAGAAGG + Intergenic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1014241172 6:119019153-119019175 GTAAGGGAACAGATGGAGGAGGG + Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015349206 6:132196672-132196694 TTGAGGGACCAGATGAATGATGG - Intergenic
1015955103 6:138590467-138590489 AGGAAGAACCAGAGGGAAGAGGG - Intronic
1016026694 6:139294590-139294612 GTGAGGGTGCAGTGAGAAGAAGG + Intergenic
1016764033 6:147772638-147772660 GTGAGGACCCAGAGAGAAGGTGG - Intergenic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017767166 6:157616286-157616308 GTGAGGGATGAGGGGGCAGAGGG + Intronic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018589937 6:165408742-165408764 GCCAGGGAGAAGAGGGAAGAAGG + Intronic
1019018982 6:168901784-168901806 GGGAAGAACAAGAGGGAAGACGG + Intergenic
1019332354 7:466666-466688 GTGAGGGAGGAGAGTGAAGGAGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1020035371 7:4960179-4960201 GTGGGGGACCCGAGGGTAGGGGG + Intergenic
1020077056 7:5265169-5265191 GTGAGGGACCAGGTCGCAGAGGG + Intergenic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1022092076 7:27114130-27114152 GGGAGGGACCGGAGGGAGAAGGG + Intronic
1022251209 7:28610254-28610276 GGGAGGGGCCAGAGGGAAGGCGG + Intronic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022566882 7:31412806-31412828 GTGAGGGATCAGGGGAAAGGAGG + Intergenic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1023305108 7:38817816-38817838 GTTTGTGACCGGAGGGAAGAAGG - Exonic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024047085 7:45592309-45592331 GTGAGGGCACAGAGGGAAGGCGG - Intronic
1024171337 7:46791067-46791089 GTGAAGGATAAGGGGGAAGAAGG + Intergenic
1024581413 7:50803880-50803902 GTAAGGGAGCAGAGGAAACATGG + Intergenic
1024604144 7:51011041-51011063 CTGATGGAGCAGAGGGCAGACGG - Intergenic
1024717514 7:52096750-52096772 GTCAGGGATTAGAGGGAGGAAGG + Intergenic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1028424982 7:90676453-90676475 GTGAGGGAGGAGAGGGTAGTAGG + Intronic
1028847370 7:95497047-95497069 GGGAAGGACAAGAGGGTAGAGGG + Intronic
1028892881 7:96008307-96008329 GGGAGAGAGCAGAGGGAAGGGGG + Intronic
1029306287 7:99622402-99622424 GTGTGGTACCAGAGTGAAAAGGG + Intronic
1029413091 7:100427792-100427814 GTGAGGGAAGAGAGGAAAAATGG - Intronic
1029526463 7:101097607-101097629 CTTAGGGACCAGATGGAAGAGGG + Intergenic
1029978243 7:104853667-104853689 GAGAGGGACCACAGGAAAAAGGG + Intronic
1030638275 7:111974644-111974666 GGGAGAGACCAGGGGGAAGTAGG + Intronic
1031052128 7:116954367-116954389 CGAAGGGACCGGAGGGAAGAGGG + Intronic
1031182545 7:118435901-118435923 GTGAGGGTTCCCAGGGAAGAGGG - Intergenic
1031824218 7:126542798-126542820 GTGACAGATCAGAGGGAGGATGG + Intronic
1032539259 7:132689742-132689764 GGGAGGGACCAATGGGAAGAAGG + Intronic
1032606848 7:133364745-133364767 GTGAGATACCAGATGGCAGATGG - Intronic
1032818450 7:135501440-135501462 ATGAGGGACTAAAGAGAAGATGG + Intronic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033824107 7:145168715-145168737 GTAAGAAACCAGAGGGAATAAGG + Intergenic
1034402703 7:150876078-150876100 GTGAGGACGCAGTGGGAAGATGG - Intergenic
1035251927 7:157603381-157603403 GTGAGGGACCACAGGCCACAGGG + Intronic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1035869124 8:3118026-3118048 TTGTAGGACCAGAGGGAAAAAGG - Intronic
1036519034 8:9473365-9473387 GTTAGGGAAGAGAGGGAGGATGG - Intergenic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1038416845 8:27403068-27403090 GTCAGGAAGCAGAGAGAAGAAGG - Intronic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1038745071 8:30247994-30248016 GTGAGGGAACAGAGAAAGGAGGG - Intergenic
1039187264 8:34931153-34931175 GGGAGGGAACAGAGGGAGGGAGG + Intergenic
1039382581 8:37099931-37099953 GGCAGGGACGGGAGGGAAGAGGG - Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040688904 8:49910726-49910748 GTGGGAGACCAGAGGGAAAATGG + Intronic
1041311589 8:56523030-56523052 GTGAGGGATCAGAGGCAGGAAGG - Intergenic
1041953619 8:63533155-63533177 GGGAGGGAAAAGAGGGAAGGAGG - Intergenic
1042801192 8:72719680-72719702 GTGAGGGAGCAGAGCAAAGGAGG - Intronic
1042852289 8:73227832-73227854 GGGTAGGACCAGATGGAAGAAGG - Intergenic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1044839621 8:96326765-96326787 GGGAGAGTCTAGAGGGAAGATGG + Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045235093 8:100345195-100345217 GTGAGGGACATGAGGGAATTTGG + Intronic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048936914 8:139365080-139365102 GTGAGGACCCAGGGAGAAGACGG - Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1048946143 8:139449328-139449350 GTGAGGGCACAGGGAGAAGAGGG - Intergenic
1048987020 8:139740200-139740222 GCCAGGGACAGGAGGGAAGAGGG - Intronic
1048997152 8:139801182-139801204 GTGAGGTGCCAGAGGAATGAGGG + Intronic
1049409563 8:142466432-142466454 GAGAGGGGCCAGAGGAAGGAGGG + Intronic
1049470568 8:142773431-142773453 GTGACTCCCCAGAGGGAAGATGG - Intronic
1049476528 8:142799557-142799579 GTGAGGGGCCAGCTGGAAGAGGG + Intergenic
1049609900 8:143550069-143550091 TTGCGGACCCAGAGGGAAGAAGG - Intergenic
1049702148 8:144020193-144020215 GAGATGGTCCTGAGGGAAGAGGG - Intronic
1049702228 8:144020528-144020550 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702323 8:144020882-144020904 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049702418 8:144021220-144021242 GAGAGGGTCCTGAGGGAAGGCGG - Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702490 8:144021494-144021516 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702600 8:144021942-144021964 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702697 8:144022341-144022363 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702752 8:144022563-144022585 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702820 8:144022834-144022856 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049702992 8:144023447-144023469 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049703056 8:144023715-144023737 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703290 8:144024525-144024547 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703307 8:144024588-144024610 GAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703345 8:144024748-144024770 GAGAGGGTCCTGAGGGAAGGAGG - Intronic
1049703366 8:144024816-144024838 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1051044453 9:12856573-12856595 GTGAGGGGGCAGATGGATGAAGG + Intergenic
1051806917 9:21004937-21004959 GTGAGGGCTCAAAGAGAAGAGGG + Exonic
1051882974 9:21859015-21859037 GTGAGGTTCCAGTGAGAAGATGG - Intronic
1051924030 9:22301293-22301315 GTAAAGTACCAGAGGCAAGAGGG + Intergenic
1051978864 9:22988666-22988688 GTGAGGGACCATATGTATGATGG - Intergenic
1052219117 9:25998191-25998213 GTAAAGGAACATAGGGAAGATGG - Intergenic
1052835410 9:33246504-33246526 GTGAGGTATCAGAGTCAAGAAGG - Intronic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052976070 9:34411174-34411196 GTGAGGGAAGAGAGGAAACAGGG - Intronic
1053204050 9:36171626-36171648 GTGAAAGACCGGAGGGAAGCAGG - Intergenic
1053231911 9:36417191-36417213 GTGAGTGCCCAAAGTGAAGAGGG - Intronic
1054453933 9:65420138-65420160 GGGAGGGGCAAGAAGGAAGAAGG + Intergenic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1054454076 9:65420545-65420567 GAGAGGGATAGGAGGGAAGAAGG + Intergenic
1054454084 9:65420576-65420598 GAAAGGGACGGGAGGGAAGAAGG + Intergenic
1054454100 9:65420619-65420641 GGGAGGGACGGGAGGGAAGAAGG + Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057370039 9:94462971-94462993 GTGAGGGGACACTGGGAAGAGGG + Intergenic
1057929457 9:99180928-99180950 ATGAGAGATCAGAGGGCAGAGGG - Intergenic
1059584838 9:115594989-115595011 GTTGGGGGTCAGAGGGAAGAGGG - Intergenic
1060546708 9:124466212-124466234 GTGAGGGGCCAGAAGCAAGCAGG - Intronic
1060658289 9:125387883-125387905 GTGAAGGCCCAGAGGGGACACGG + Intergenic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1061014726 9:127975097-127975119 GTGAGGGACCAGGGGGGTGGAGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061278825 9:129585391-129585413 GGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1061466039 9:130780589-130780611 GAGAGGGAGATGAGGGAAGAGGG - Intronic
1061630086 9:131866883-131866905 CTGAGGGACCCGAGGAAAGGAGG - Intronic
1061714987 9:132513448-132513470 GGGAGGGTCCTCAGGGAAGACGG - Intronic
1061989807 9:134152728-134152750 ATGACAGACTAGAGGGAAGAAGG - Intronic
1062206731 9:135341731-135341753 GTGAGGGACCACAGGGGAAGTGG - Intergenic
1062362604 9:136194748-136194770 GGGAGGGAAGAGGGGGAAGAGGG - Intergenic
1203771328 EBV:51390-51412 GAGACGGACCAGGGGGAAAAGGG - Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185515913 X:698955-698977 GTGGGGGCCCAGTGGTAAGAAGG + Intergenic
1185571286 X:1136824-1136846 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185606301 X:1368934-1368956 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606342 X:1369169-1369191 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606385 X:1369404-1369426 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606426 X:1369636-1369658 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606467 X:1369871-1369893 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606550 X:1370333-1370355 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606720 X:1371266-1371288 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606763 X:1371498-1371520 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606936 X:1372433-1372455 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606979 X:1372665-1372687 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607153 X:1373598-1373620 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607278 X:1374297-1374319 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607319 X:1374532-1374554 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607402 X:1374996-1375018 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607490 X:1375462-1375484 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607667 X:1376395-1376417 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185610030 X:1388843-1388865 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185610065 X:1389077-1389099 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185618424 X:1437473-1437495 GTGAGGACACAGGGGGAAGACGG - Intronic
1185672189 X:1821682-1821704 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185682023 X:1896832-1896854 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185734301 X:2485626-2485648 GGGAGGGAGGAGAGGGAAGGAGG + Intronic
1185752911 X:2628320-2628342 GTGAAGGATGAGAGGGGAGAGGG + Intergenic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1185986955 X:4845423-4845445 GTGAGGGCACAGAGAAAAGACGG + Intergenic
1186406929 X:9312856-9312878 GTGATGGATGGGAGGGAAGAAGG + Intergenic
1187182765 X:16958639-16958661 GAGAGGGGCCAGTGGGATGAGGG + Intronic
1187504438 X:19867315-19867337 GGGAGGGAGGAAAGGGAAGAGGG + Intronic
1187933284 X:24313026-24313048 GTGATGCTCCAGAGAGAAGATGG - Intergenic
1187938943 X:24363028-24363050 GTGATGCTCCAGAGAGAAGATGG + Intergenic
1188505995 X:30885623-30885645 GTGAGGAAACAGTGCGAAGATGG + Intronic
1189091839 X:38091593-38091615 GAGAGGGAGCACAGGGAAGTGGG + Intronic
1189186795 X:39061857-39061879 TTGAGGGACTAGAGGGATGGTGG - Intergenic
1189271042 X:39752177-39752199 GTGAGGAAACAGAGAGAAGGTGG + Intergenic
1192337516 X:70234554-70234576 GGGAAGGACAAGAGGGAAGAGGG + Intergenic
1192451076 X:71245458-71245480 GTGAGCAACCAGAGTGCAGAGGG - Exonic
1193317113 X:80077137-80077159 GTGGGGAATCACAGGGAAGAGGG + Intergenic
1193990385 X:88299747-88299769 GTGAGGGTACAGGGAGAAGATGG + Intergenic
1194641327 X:96406944-96406966 ATGGGGGACCACAGGGTAGAGGG - Intergenic
1194957399 X:100197032-100197054 GTGAGGGCTCAGAAGGAAAAGGG + Intergenic
1195460028 X:105114209-105114231 GTGAGGTTACAGTGGGAAGATGG + Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196009901 X:110875593-110875615 GTGAGGGCCCAGCGGAAAGGTGG + Intergenic
1196251056 X:113460465-113460487 GTGAGGGCTCAGATGGAAGGGGG - Intergenic
1196377920 X:115055200-115055222 GTGAGGGAAGAGAGAGAACAAGG - Intergenic
1196683983 X:118495576-118495598 GCGAGGGTCACGAGGGAAGAGGG - Intergenic
1196813792 X:119649032-119649054 GTGGGGGAGGAGAGGAAAGATGG + Intronic
1197865758 X:131014984-131015006 GTGTGGGAGCAGAGGGTATATGG - Intergenic
1198129352 X:133678308-133678330 TTGAGAGAGCAAAGGGAAGAGGG + Intronic
1198609027 X:138376483-138376505 GAGAAGGACCAGTGGGAAGCTGG - Intergenic
1198609599 X:138383182-138383204 GGGAAGGGCCAGAGGGCAGAAGG - Intergenic
1199935464 X:152569235-152569257 GTTATGGACAAGAAGGAAGAGGG + Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1200957535 Y:8967154-8967176 GTGAGGGACGGGAGGGAGGGAGG - Intergenic
1201146591 Y:11068046-11068068 GGGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201146605 Y:11068095-11068117 GAGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic