ID: 903407792

View in Genome Browser
Species Human (GRCh38)
Location 1:23113083-23113105
Sequence TTCTAGTTCTTTATGTAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 673}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903407792_903407798 25 Left 903407792 1:23113083-23113105 CCAAATTACATAAAGAACTAGAA 0: 1
1: 0
2: 4
3: 52
4: 673
Right 903407798 1:23113131-23113153 GCCTGTAATCCTGGCACTTTGGG 0: 984
1: 19435
2: 244999
3: 273215
4: 174183
903407792_903407794 -6 Left 903407792 1:23113083-23113105 CCAAATTACATAAAGAACTAGAA 0: 1
1: 0
2: 4
3: 52
4: 673
Right 903407794 1:23113100-23113122 CTAGAAAAAGCATCTGGACACGG 0: 1
1: 0
2: 2
3: 39
4: 598
903407792_903407795 -3 Left 903407792 1:23113083-23113105 CCAAATTACATAAAGAACTAGAA 0: 1
1: 0
2: 4
3: 52
4: 673
Right 903407795 1:23113103-23113125 GAAAAAGCATCTGGACACGGTGG 0: 1
1: 0
2: 1
3: 53
4: 970
903407792_903407797 24 Left 903407792 1:23113083-23113105 CCAAATTACATAAAGAACTAGAA 0: 1
1: 0
2: 4
3: 52
4: 673
Right 903407797 1:23113130-23113152 TGCCTGTAATCCTGGCACTTTGG 0: 512
1: 10058
2: 111859
3: 244483
4: 241278
903407792_903407796 16 Left 903407792 1:23113083-23113105 CCAAATTACATAAAGAACTAGAA 0: 1
1: 0
2: 4
3: 52
4: 673
Right 903407796 1:23113122-23113144 GTGGCTCATGCCTGTAATCCTGG 0: 1406
1: 3588
2: 4650
3: 4179
4: 4000
903407792_903407800 28 Left 903407792 1:23113083-23113105 CCAAATTACATAAAGAACTAGAA 0: 1
1: 0
2: 4
3: 52
4: 673
Right 903407800 1:23113134-23113156 TGTAATCCTGGCACTTTGGGAGG 0: 1442
1: 26662
2: 318278
3: 258215
4: 140881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903407792 Original CRISPR TTCTAGTTCTTTATGTAATT TGG (reversed) Intronic
900976943 1:6023662-6023684 TTTTAGTTCTCTATGTATTCTGG + Intronic
902945387 1:19832983-19833005 TTCTAGTTTTTCATCAAATTTGG - Intergenic
903095494 1:20968851-20968873 TTCAAGTTCATTATGTAAAATGG - Intronic
903407792 1:23113083-23113105 TTCTAGTTCTTTATGTAATTTGG - Intronic
905315202 1:37078371-37078393 TTCTCGTTCATTATGGAATCAGG + Intergenic
907752767 1:57279228-57279250 TTCAAGTTCTTTATATAAAATGG + Intronic
908286904 1:62615121-62615143 TATTATTTCTTTATGTAATTTGG + Intronic
908631126 1:66108565-66108587 TTTCAGTTCCTTATGTATTTTGG - Intronic
908724803 1:67164128-67164150 TTTGAGTTCCTTATGTATTTTGG - Intronic
909505589 1:76386042-76386064 TTCATGTTCTTTATTTAAGTTGG + Intronic
909786998 1:79625910-79625932 ATTTAGTTCATTATGTAATGTGG + Intergenic
910373082 1:86539033-86539055 TTCTGGCTCTCTATGTAAGTGGG + Intergenic
910718019 1:90253708-90253730 TTATAGTTCTTTAATTCATTTGG + Intergenic
910735464 1:90449898-90449920 TTCTAGTTGTTTATGTTGTGAGG - Intergenic
910843161 1:91580492-91580514 TTTGAGTTCCTTATGTATTTTGG - Intergenic
910907817 1:92200161-92200183 TTGTACTTCTTTATGTCATGGGG + Intergenic
911162562 1:94696243-94696265 TTTAAGTTCTTTATGTATTCTGG - Intergenic
911177384 1:94830619-94830641 TTCTAGTTTTTTTTTAAATTGGG - Intronic
911898912 1:103475457-103475479 GTATAGTTCTTTCTGTAATGGGG - Intergenic
912253562 1:108036050-108036072 TTCTAGGTCTTTCTATAATTTGG + Intergenic
912612653 1:111063926-111063948 TTCTACTTCTTTGTGTGAGTGGG + Intergenic
913429496 1:118775329-118775351 TTTTAGTTCTTTATATATTTTGG + Intergenic
913431398 1:118796503-118796525 TTTTAGTTTTTTATGTCTTTTGG + Intergenic
914325163 1:146606611-146606633 TTCTATTTTTTTTTGTATTTTGG + Intergenic
914714729 1:150245092-150245114 TTCAAGTTTTTTCTTTAATTTGG + Intergenic
916259455 1:162826501-162826523 TAGTAGTTCTTTATGTATTCTGG + Intronic
916913494 1:169379397-169379419 TGCTAGTTCATTATGCTATTTGG + Intronic
918198306 1:182243331-182243353 TTATATTTCTTCATGAAATTCGG + Intergenic
918808247 1:189078656-189078678 TTCTATCACTTTATGTAATAAGG - Intergenic
918907295 1:190513421-190513443 ATCTAGTTCTTTTTGTTACTAGG + Intergenic
919436513 1:197569050-197569072 TTTGAGTTCTTTATATATTTTGG - Intronic
920326240 1:205166991-205167013 TTATAGTTATTTATGTACTGCGG - Intronic
920918969 1:210282281-210282303 TTCCAATTCTTTATGTAGTTTGG + Intergenic
921197597 1:212774459-212774481 TACTGGTTCTTTATGTATTCTGG - Intronic
921427138 1:215016866-215016888 TTTGAGTTCCTTATGTATTTTGG - Intronic
921474062 1:215584197-215584219 TTTGAGTTCTTTCTGCAATTTGG - Intronic
921815081 1:219554338-219554360 GCCTAGTTCTTCATGTGATTTGG - Intergenic
921963371 1:221060289-221060311 TCCTAGTTTTTTTTGTCATTTGG + Intergenic
922454159 1:225761152-225761174 TAGGAGTTCTTTATGTATTTTGG + Intergenic
923433229 1:233944112-233944134 TTCTAGTTCTTTTAGTTATGAGG - Intronic
923641017 1:235760804-235760826 TTCTAGTTATTTCTGGATTTGGG + Intronic
924636697 1:245795004-245795026 CTCTATTTCTTTATGTGTTTTGG + Intronic
1064222051 10:13449603-13449625 TTCTAGTTCATTTTATATTTTGG + Intronic
1064533847 10:16338052-16338074 TTTGAGTTCCTTATTTAATTTGG - Intergenic
1064853015 10:19731839-19731861 TTCTCTTTCTTTATGAAAATAGG + Intronic
1064863313 10:19851305-19851327 TTCTAGTTCTTAAAATATTTAGG + Intronic
1065310803 10:24414576-24414598 TTCTACCTCTGTATGTAATGGGG + Intronic
1065327499 10:24561861-24561883 TTCTATTTCTTGATGTCATGTGG - Intergenic
1065404903 10:25352791-25352813 TTTTAGATATTTATGGAATTAGG + Intronic
1065520942 10:26571572-26571594 TTCTATTTCTTTATCTATTCTGG + Intergenic
1065761410 10:28986596-28986618 TGATAGTTCTTCATGTAATAGGG - Intergenic
1065985196 10:30944000-30944022 TTTCAGTTCCTTATGTCATTTGG - Intronic
1066701250 10:38131077-38131099 TTCATGTTCTTTATATATTTTGG + Intergenic
1067304911 10:45054257-45054279 TTTGAGTTCCTTATGTATTTTGG + Intergenic
1067370280 10:45676206-45676228 TACAAGTTCTTTAGGTATTTTGG - Intergenic
1067396439 10:45924325-45924347 TTGTAGTTCTTTATATATTCTGG + Intergenic
1067864760 10:49893433-49893455 TTGTAGTTCTTTATATATTCTGG + Intronic
1068232443 10:54186772-54186794 TTCTAGTTATCTGAGTAATTGGG - Intronic
1068401481 10:56533523-56533545 TTCTAGGTCTCTGTGAAATTTGG - Intergenic
1068482728 10:57614243-57614265 TTTTAGTTCTTTCTATATTTTGG - Intergenic
1068591635 10:58858841-58858863 TTTGAGTTCTTTATGTATTCTGG + Intergenic
1069147559 10:64914796-64914818 TTTGAGTTCTTTAGGTATTTTGG + Intergenic
1069633590 10:69912331-69912353 TCCTAGTTCCTCCTGTAATTAGG - Intronic
1070363590 10:75714563-75714585 TTCTGGTTCTTTTTGTAGTATGG + Intronic
1070475383 10:76824122-76824144 TTTTAGGTATTTATCTAATTAGG - Intergenic
1070884720 10:79880260-79880282 TTTTAGGTCTCTATGTACTTAGG - Intergenic
1071261275 10:83921286-83921308 TTTGAGTTCTTTACGTATTTTGG - Intergenic
1071286287 10:84149603-84149625 TGCTGTTTCTTTATGTAATAAGG - Intronic
1071333115 10:84580763-84580785 TTCGAGTTCTTTATATATTTTGG - Intergenic
1071704795 10:87986034-87986056 TAGTAGTTCTTTATATATTTTGG - Intergenic
1072113836 10:92349037-92349059 TTCTATTCCTTTATTTGATTTGG - Intronic
1072288071 10:93935914-93935936 TTGCAGTTCTTTCTGTCATTAGG - Intronic
1073896634 10:108168088-108168110 TTCTATCCCTTTATGTAAGTAGG + Intergenic
1074044485 10:109824733-109824755 TTCTAGTTCTCTATTTGAATGGG - Intergenic
1074343633 10:112658801-112658823 TTCTAGTTTCTTTTGAAATTTGG - Intronic
1074484288 10:113857998-113858020 ATCTAATTGTTTATGTAATTAGG + Intronic
1075229491 10:120662103-120662125 TTCTAATTCTTTATGGAGTTTGG - Intergenic
1076609619 10:131714188-131714210 TTTGAGTTCCTTATGTATTTTGG + Intergenic
1078366394 11:10710161-10710183 TTCTTTTTCTTTCTTTAATTCGG - Intergenic
1078482019 11:11685701-11685723 TAGAAGTTCTTTATGTAATTTGG - Intergenic
1078558043 11:12346735-12346757 TTCCAGCTCTTTAGGTAACTGGG - Intronic
1078632852 11:13019266-13019288 TTGGAGTTCTTTATTTACTTTGG + Intergenic
1079632867 11:22698926-22698948 TTCTTGTGCTTTATTTTATTAGG + Intronic
1080280270 11:30548942-30548964 GTCTAGATTTTTATGTAAATTGG - Intronic
1080364996 11:31563792-31563814 TTTTGGTTCTTTCTGCAATTTGG - Intronic
1080488713 11:32738571-32738593 TTTGAGCTCTTTATGTATTTTGG + Intronic
1081089522 11:38846160-38846182 TGTAAGTTCTTTATGTAACTGGG - Intergenic
1081478967 11:43466053-43466075 TACAAGTTGTTTATATAATTTGG - Intronic
1081624928 11:44648112-44648134 TAAGAGTTCTTTATGTATTTTGG - Intergenic
1082937814 11:58672660-58672682 TTTTTGTTTTTTAAGTAATTTGG - Intronic
1083004383 11:59328135-59328157 TTTGAGTTCCTTATGTATTTTGG + Intergenic
1083005331 11:59339392-59339414 TTTGAGTTCTTTATGTATTCTGG + Intergenic
1085894212 11:80618114-80618136 TTTGAGTTCTTTATATATTTTGG - Intergenic
1087471640 11:98583331-98583353 TTTGAGTTCTTTATGTATTTTGG + Intergenic
1088545460 11:110954542-110954564 TTGTAGGTCTCTATATAATTGGG + Intergenic
1088834830 11:113568732-113568754 GTCTTGTTTTTAATGTAATTTGG + Intergenic
1089761180 11:120725042-120725064 TTATTATTCTTTATATAATTAGG + Intronic
1090737828 11:129626509-129626531 TTGTAATTCTTTATGTATTCTGG + Intergenic
1091593982 12:1862845-1862867 TAGGAGTTCTTTATGTATTTTGG + Intronic
1092654413 12:10669753-10669775 TTTTAGTTCCCTATGTATTTTGG - Intronic
1092665079 12:10787365-10787387 TTTGAGTTCCTTATGTATTTGGG + Intergenic
1092929596 12:13303079-13303101 TACAAGTTCTTTATATATTTTGG + Intergenic
1093715240 12:22374488-22374510 TTCTGGTAGTTTTTGTAATTAGG + Intronic
1094413977 12:30198720-30198742 TACTAGTTCTTGAAGAAATTCGG - Intergenic
1095045941 12:37505447-37505469 TTCTAGCTCTTGATTTATTTAGG + Intergenic
1095236910 12:39807666-39807688 TTCTATTTCTTTTTGTGTTTTGG + Intronic
1095271912 12:40228469-40228491 TTTTAGTTCCTTATGTATTCTGG + Intronic
1095276644 12:40292321-40292343 TTCTTGTTGTTTATGTGAGTAGG + Intronic
1095667709 12:44821459-44821481 TTTTAGTTCTTTAAGTAAGTAGG + Intronic
1095844036 12:46726946-46726968 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1096962789 12:55597537-55597559 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1097379123 12:58874264-58874286 TCCTTTTTCTTTATGTAACTGGG + Exonic
1097501372 12:60408757-60408779 CTCTAATTCTTTTTGTAACTGGG + Intergenic
1097660945 12:62430501-62430523 TTATAGTTCTATATGAATTTTGG - Intergenic
1098177421 12:67807131-67807153 TGCAAGTTGTTTATTTAATTAGG + Intergenic
1098485325 12:71014748-71014770 TGAGAGTTCTTTATGTATTTTGG - Intergenic
1098545209 12:71704322-71704344 TACTAGTCCTTTATCTAATTGGG - Exonic
1099277521 12:80596344-80596366 TTCTACTTGCTTATGTAAATAGG - Intronic
1099530193 12:83770249-83770271 TTATTGTGATTTATGTAATTTGG - Intergenic
1099571727 12:84329311-84329333 TATTAGTTCTTTCTGTTATTTGG + Intergenic
1099968330 12:89474747-89474769 TTCCAGTGCTCTAAGTAATTTGG - Intronic
1100346110 12:93733224-93733246 TTGTAATTCTTTAAGAAATTGGG + Intronic
1100418401 12:94403206-94403228 TTCTAATTCTTGTTGTATTTGGG + Exonic
1100737098 12:97547764-97547786 TTTGAGTTCTTTATATATTTTGG + Intergenic
1100785955 12:98078667-98078689 TTTGAGTTCTGTATGTATTTTGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104027016 12:125034900-125034922 TTCTAGCATTTTATGTAAATGGG + Intergenic
1105302244 13:19146389-19146411 TTGTAGTTCTTTATGTATTTTGG - Intergenic
1105416466 13:20217340-20217362 TGATAGTTCTTTATGTATTCTGG - Intergenic
1106136071 13:26974717-26974739 TTTTATTTCTATATGTTATTGGG + Intergenic
1106151128 13:27103562-27103584 TACTAATTCTTTTTGTATTTAGG - Intronic
1107918344 13:45176502-45176524 TTGTAGTTCTTTATATATTCTGG + Intronic
1108417690 13:50216346-50216368 TTCTAGTTTCTTAAGGAATTAGG - Intronic
1108426149 13:50302751-50302773 TTCTATTTCTCCCTGTAATTTGG - Intronic
1108718117 13:53102395-53102417 TTCTGGTTCTGTATGTTATGAGG + Intergenic
1108794892 13:54018727-54018749 TCCTTGTTCATTATGGAATTTGG + Intergenic
1108971848 13:56386304-56386326 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1110244376 13:73305441-73305463 ATCTATTGCTTTATGTAAGTGGG + Intergenic
1110696031 13:78490745-78490767 TGTTAGTTCTTTATGCATTTTGG - Intergenic
1110869136 13:80430233-80430255 TTCTAGTTCTTTATGATTATTGG + Intergenic
1111188975 13:84783598-84783620 TTCTAGTACTTCATGTTATTTGG + Intergenic
1111288853 13:86134377-86134399 TACTAGTTATTTATATATTTAGG - Intergenic
1111689120 13:91539089-91539111 TTCTGTTTAGTTATGTAATTAGG - Intronic
1111701988 13:91702164-91702186 TTTGAGTTCCTTATGTATTTTGG + Intronic
1111863430 13:93738134-93738156 TGCTAGTGCTTCATGTAATATGG + Intronic
1111988541 13:95090667-95090689 TTCTAGTTCCTTTTCTCATTTGG - Intronic
1112094111 13:96113496-96113518 TTCTAGTTATTTATTTACTAAGG - Intronic
1112928340 13:104705079-104705101 TTCTAGCTTGTTTTGTAATTCGG + Intergenic
1113050473 13:106205956-106205978 TTCTAGTTCTATTTGTTCTTGGG - Intergenic
1113215147 13:108031233-108031255 TTCTATTCATTTATTTAATTAGG - Intergenic
1113260494 13:108556503-108556525 TTTGAGTTCCTTATGTATTTTGG + Intergenic
1113439719 13:110318818-110318840 TTCAAGTTCTTTAGGTATTGAGG - Intronic
1113605101 13:111599413-111599435 ATCTATTTCATTATGTTATTAGG - Intronic
1113718803 13:112535644-112535666 TGATAGTTCTTTATGTATTTGGG + Intronic
1113971204 13:114191389-114191411 TAAGAGTTCTTTATGTATTTTGG - Intergenic
1114229358 14:20766473-20766495 TTCTATTTATTTATTTACTTTGG - Intergenic
1114298912 14:21356305-21356327 TTCTAGTTCTGTGTGAGATTGGG - Intronic
1114489289 14:23087688-23087710 TTTTAGTTCTATAGGTAATGGGG - Intronic
1115179464 14:30605559-30605581 TTTTAGTTTTTTTTTTAATTTGG - Exonic
1115726256 14:36219533-36219555 TTCTAGTTCTTTATATATTTGGG - Intergenic
1115728472 14:36242343-36242365 TTCTGATTCTTTATGTTTTTCGG - Intergenic
1116286455 14:42978954-42978976 TTTGAGTTCTTTATATATTTTGG + Intergenic
1116315454 14:43385102-43385124 TTTTGGTTCTTTATATAGTTTGG - Intergenic
1116349799 14:43846840-43846862 TTATAGTACTTTAAATAATTTGG + Intergenic
1116735510 14:48685913-48685935 TTTGATTTCTTTATGTATTTAGG - Intergenic
1116754797 14:48933687-48933709 TTGTATTTCTATATGTATTTTGG - Intergenic
1116915584 14:50522181-50522203 TTCTAGTTCTTTGTTTACATAGG - Intronic
1116929184 14:50672894-50672916 TACTAATTCTTTATGTTACTGGG - Intergenic
1117758666 14:59003400-59003422 TTCTAGTTCTGTAAGTAAATAGG - Intergenic
1117934349 14:60885630-60885652 TTCAAGTTCTTTATATAATTTGG + Intronic
1118145697 14:63133309-63133331 TTTGAGTTCTTTACGTATTTTGG - Intergenic
1118475589 14:66113847-66113869 TTATAGTTCTTTATATATTTTGG + Intergenic
1118511388 14:66478031-66478053 TTAAACTTCTTTATGAAATTGGG + Intergenic
1118529532 14:66687464-66687486 TTCTTTTTCTTTATTTTATTTGG + Intronic
1118582941 14:67322681-67322703 TTAGAGTTCTTTATATTATTTGG + Intronic
1119063381 14:71500254-71500276 TTGTAGCTCTTTATGTATTGTGG - Intronic
1119145887 14:72313685-72313707 TGTTAGTTCTTTATTTTATTGGG - Intronic
1120049906 14:79853310-79853332 TACTAGTATTTTATGTATTTTGG + Intronic
1120138807 14:80903619-80903641 TTTGAGTTCTTTATATATTTTGG - Intronic
1120795403 14:88626667-88626689 ATCTAGTTCTTTCAGAAATTAGG - Exonic
1120964006 14:90151502-90151524 TTTGAGTTCCTTATGTATTTTGG + Intronic
1121028763 14:90639325-90639347 TAATATTTCTTTATGTATTTTGG - Intronic
1121892713 14:97610777-97610799 TTTTAGTTCTTTGTGTATTCTGG + Intergenic
1122350399 14:101086466-101086488 TTTGAGTTCTTTATATATTTTGG + Intergenic
1122944463 14:105000184-105000206 TTTGAGTTCCTTATGTATTTTGG - Intronic
1123671124 15:22659153-22659175 TTCTACTTCATTAATTAATTCGG + Intergenic
1124069065 15:26374431-26374453 TTCAAGATCATTATGAAATTTGG - Intergenic
1124146407 15:27129924-27129946 TTGTAGTTCTTTATATATTCTGG + Intronic
1124189361 15:27560244-27560266 TGACAGTTCTTTATGTATTTTGG + Intergenic
1124323165 15:28732378-28732400 TTCTACTTCATTAATTAATTCGG + Intronic
1124527059 15:30465526-30465548 TTCTACTTCATTAATTAATTCGG + Intergenic
1124530625 15:30502345-30502367 TTCTACTTCATTATGTAGTACGG - Intergenic
1124580013 15:30945287-30945309 TTCTAGTGCTCTTTTTAATTTGG - Intronic
1124771594 15:32542157-32542179 TTCTACTTCATTAATTAATTCGG - Intergenic
1125040659 15:35183001-35183023 TTTCAGTTCTTTCTGTAATGTGG - Intergenic
1125432659 15:39611179-39611201 TTTTACATCTTTTTGTAATTTGG - Intronic
1125441769 15:39710979-39711001 TTCCAGTGCCTTATGGAATTTGG - Intronic
1125457386 15:39874009-39874031 TTTGAGTTCTTCATGTCATTAGG - Intronic
1126287063 15:47025781-47025803 TTCAAATTCTTTATGTATTTTGG - Intergenic
1127029167 15:54842619-54842641 TTCTTGGTCTTTATGTAAAATGG - Intergenic
1127135262 15:55914412-55914434 CAAAAGTTCTTTATGTAATTTGG - Intronic
1127553931 15:60068696-60068718 TGCCAGTTCTTTAGGTACTTTGG + Intergenic
1127578908 15:60318907-60318929 CTCTATTTCTTTAAGTAGTTAGG + Intergenic
1128813403 15:70587839-70587861 TCCTAGTTCTGTATGGAGTTTGG - Intergenic
1128956976 15:71957638-71957660 TTCTGTTTGTTTATGTAAGTGGG - Intronic
1130116424 15:81008636-81008658 TTCATGTTTATTATGTAATTGGG + Intronic
1130824333 15:87528399-87528421 TTGTAGTTCTTGACATAATTGGG + Intergenic
1131573494 15:93563289-93563311 TTCTAGTTCTCTTTGTGACTTGG + Intergenic
1131610745 15:93959743-93959765 TTTTTTTTCTTTATGTATTTTGG + Intergenic
1131637726 15:94255548-94255570 TTAGAGGTCTTTATGTAAATAGG - Intronic
1132194380 15:99900277-99900299 TTTGAGTTCTTTATATATTTTGG - Intergenic
1132990974 16:2793621-2793643 CTGTAGTTCTTTATGTATTCTGG + Intergenic
1133126464 16:3650079-3650101 TTCTAGTTTTGTTTGTAAGTAGG + Intronic
1134261872 16:12657351-12657373 CTGCAGTTCTTTATGTATTTTGG + Intergenic
1134556097 16:15166523-15166545 TTTTATTTCTTTATCTTATTTGG + Intergenic
1134848795 16:17463339-17463361 TTTGAGTTCTTTATATATTTTGG - Intronic
1134916681 16:18078258-18078280 TTTTATTTCTTTATCTTATTTGG + Intergenic
1135004956 16:18812223-18812245 TTATAGTTGATTATTTAATTGGG - Intronic
1135051628 16:19197745-19197767 TTCTAGTTCATTTTATAACTAGG - Intronic
1137436529 16:48458715-48458737 TTGCAGTTCTTTATGCATTTTGG + Intergenic
1137504238 16:49037583-49037605 TTCATGTCTTTTATGTAATTGGG + Intergenic
1138879748 16:60997365-60997387 TAAGAGTTCTTTATGTATTTCGG + Intergenic
1138995312 16:62444686-62444708 TTGTAGTTTTTTATATATTTTGG - Intergenic
1139196812 16:64929245-64929267 TCTGAGTTCTTTATGTATTTTGG - Intergenic
1139293919 16:65883264-65883286 ATGTAGTTCTTTATGTATTCTGG - Intergenic
1140008402 16:71104336-71104358 TTCTATTTTTTTTTGTATTTTGG - Intronic
1140160316 16:72484182-72484204 TTCTAGTTCATTCATTAATTTGG + Intergenic
1140543234 16:75779691-75779713 TTCTAGTTCCTTATATATTCTGG - Intergenic
1140988412 16:80183182-80183204 TGGTAGTTCTGTATTTAATTTGG - Intergenic
1144380369 17:14689437-14689459 TTGTGGTTCTTTATGACATTAGG + Intergenic
1144815799 17:18033790-18033812 TAAGAGTTCTTTATGTATTTGGG - Intronic
1146669919 17:34730029-34730051 TTCTCATTCTTTATTTATTTTGG - Intergenic
1146866484 17:36339543-36339565 TTCTAATTCTTGTTATAATTTGG + Intronic
1147069354 17:37940147-37940169 TTCTAATTCTTGTTATAATTTGG + Intergenic
1147080882 17:38019687-38019709 TTCTAATTCTTGTTATAATTTGG + Intronic
1147096825 17:38143644-38143666 TTCTAATTCTTGTTATAATTTGG + Intergenic
1147228367 17:38998847-38998869 TTCTAGCACTTTAGGTACTTAGG + Intergenic
1147567037 17:41543539-41543561 TCCTAGTACTTCATGTCATTTGG - Intergenic
1148398656 17:47333303-47333325 GTTGAGTTCCTTATGTAATTTGG + Intronic
1149153659 17:53599868-53599890 TTTTAGTTCTTTATGGATTCTGG + Intergenic
1149482704 17:57016686-57016708 TTCTATTTTTTTCTGTCATTTGG + Intergenic
1149844983 17:60003333-60003355 TTCTAATTCTTGTTATAATTTGG - Intergenic
1149890050 17:60380837-60380859 TTCTAATTCTTATTATAATTTGG - Intronic
1150533341 17:66009424-66009446 TTTTAGTTCCTTATATATTTAGG + Intronic
1151531339 17:74707254-74707276 TTTGAGTTCCTTATGTATTTTGG - Intronic
1152384350 17:79962071-79962093 TTCTAGAATTTTATGTAAATGGG - Intronic
1152529698 17:80910354-80910376 TTCTAGTTGCTTATGGAAGTTGG + Intronic
1152802541 17:82338067-82338089 TTCTATTTATTTATTTATTTGGG + Intergenic
1153404873 18:4726574-4726596 TTAGAGTTCTTTGTGTATTTTGG - Intergenic
1155017657 18:21861199-21861221 TAATGGTTCTTAATGTAATTTGG + Intronic
1155894503 18:31307223-31307245 TTATAGTTATTCATGTAATTTGG - Intergenic
1155981733 18:32187550-32187572 TTTTAGTTCTTTATATATCTTGG + Intronic
1156201169 18:34834000-34834022 TTCTAATTCTTTGTGGGATTTGG - Intronic
1156256763 18:35405584-35405606 TTGCAGTTCTTTATGTATTCTGG - Intergenic
1156284459 18:35677239-35677261 TTCTAATTCTTTGTCTAATAGGG + Intronic
1157270143 18:46268226-46268248 AGCTAGTGCTTTATGTCATTTGG + Intergenic
1157903867 18:51548076-51548098 TTTAGGTTCTTTATGTATTTTGG + Intergenic
1158500826 18:57999808-57999830 TGAGAGTTCTTTATATAATTTGG + Intergenic
1158772621 18:60538897-60538919 TGATAGTTCTTTATGCATTTTGG - Intergenic
1158984371 18:62799241-62799263 TTCATGTACTTTATGTCATTTGG + Intronic
1158990051 18:62859055-62859077 TTCTACTGCCTTGTGTAATTAGG + Intronic
1159319543 18:66829681-66829703 TTCTAGTTCTATATGAGATTTGG + Intergenic
1159361674 18:67412818-67412840 TTTTATTTGTTTAAGTAATTGGG + Intergenic
1159528289 18:69622658-69622680 TTCAAGTTCTTTATCTAAGGAGG - Intronic
1159860823 18:73647268-73647290 TTATAGTTATTTATGAAATAAGG - Intergenic
1160334388 18:78025147-78025169 TTGGAGTTCTTCATGTATTTTGG - Intergenic
1160378806 18:78433523-78433545 TTTTAATTCTTTCTATAATTAGG + Intergenic
1160384796 18:78488984-78489006 TTCTGGATCTTTTTATAATTAGG - Intergenic
1161406204 19:4092629-4092651 TTTTAGTTATTTATTTATTTTGG + Intronic
1163352737 19:16788733-16788755 TTGTAGTTTTTTCTGTTATTAGG + Intronic
1164487619 19:28673310-28673332 TTTTATTTCTTTAAGTAATGTGG - Intergenic
1164663049 19:29995438-29995460 TTGTAGTTCTTTATATATTCTGG + Intronic
1164944248 19:32279645-32279667 TTTAAGTTCTTTATGTATTTTGG - Intergenic
1167682731 19:50934667-50934689 TTCTAGTTCTTTGTCCATTTTGG + Intergenic
1167731040 19:51255557-51255579 TTTGAGTTCCTTATGTATTTTGG - Intronic
1167923754 19:52806570-52806592 TTGTAGTTCTTTAGATATTTGGG - Intronic
1167978108 19:53248829-53248851 TTCATGTTCTTTATATATTTGGG + Intronic
925677328 2:6377668-6377690 TTCTAATTCTATATATATTTTGG - Intergenic
926902097 2:17763086-17763108 TGCAAGTTCTTTATGTATTAAGG + Intronic
927401013 2:22710081-22710103 TTCAAGTTCTTTATGGACTCTGG + Intergenic
927487140 2:23496257-23496279 TTATAATTTTTTATGTAATATGG + Intronic
927776032 2:25904021-25904043 TTATACTTCTGTATGTAGTTGGG - Intergenic
927839032 2:26425780-26425802 TAGAAGTTCTTTATGTATTTTGG + Intronic
928667552 2:33565617-33565639 TTCTAGAGCTTTATATATTTTGG - Intergenic
929057357 2:37889935-37889957 TTATAGTTCTTTATATACTCTGG + Intergenic
929834416 2:45381704-45381726 TTCTCTTTCTCTTTGTAATTGGG - Intergenic
930117214 2:47728574-47728596 TTCTAGTTATTTATAAATTTTGG + Intronic
930216567 2:48703384-48703406 TTCTAGGTTTTTATGTTTTTAGG + Intronic
930326015 2:49918991-49919013 TTCTAGTGCTTTGTGTGATTGGG - Intronic
930367396 2:50457579-50457601 TTTGAGTTCTTTATGTATTCTGG - Intronic
930374782 2:50551319-50551341 TTCTATTTCTTTATTTTGTTAGG + Intronic
931487804 2:62710851-62710873 TAATACTTCTTAATGTAATTTGG - Intronic
931577947 2:63739420-63739442 TCCTAATTCTTTATCCAATTAGG + Intronic
931642056 2:64390272-64390294 TTCAACTTCTTTATGAAATATGG + Intergenic
932088568 2:68784492-68784514 TGCTAGTTTTTTTTTTAATTGGG + Intronic
932550273 2:72762491-72762513 GTCTTCTTCTTTATATAATTTGG - Intronic
932629513 2:73326990-73327012 TTCTAGTTCTATGTTTAAATTGG - Intergenic
932989507 2:76769307-76769329 TTCTAGTCCTACATGTGATTGGG - Intronic
933563687 2:83922136-83922158 TTTTTTTTCTTTTTGTAATTAGG - Intergenic
933903766 2:86869059-86869081 TTCTAGTTGCTTGTGTAATCTGG - Intergenic
934804917 2:97212226-97212248 AAGTAGTTATTTATGTAATTTGG + Intronic
934900798 2:98158520-98158542 TTCTAGTTCTTTGTGTTCTTGGG + Intronic
935477723 2:103544195-103544217 TTTGAGTTCTTTATATATTTTGG + Intergenic
935507094 2:103919149-103919171 ATTTTGTTCTTTATGTAATGGGG - Intergenic
935540947 2:104348198-104348220 TTTGAGTTCCTTATGTATTTTGG - Intergenic
936367148 2:111868179-111868201 TTCTAGTTGCTCATGTAATCTGG - Intronic
936988546 2:118336428-118336450 TTTGAGTTTTTTATGTATTTTGG + Intergenic
936990384 2:118357910-118357932 TAATAGTTCTTTATATATTTTGG + Intergenic
937020977 2:118654872-118654894 TAAGAGTTCTTTATGTAATTTGG - Intergenic
937618716 2:123959923-123959945 TATTAGTTCTTTATATATTTTGG + Intergenic
938612699 2:132965181-132965203 TTGTAGTTCTTTATGAAATCAGG + Intronic
938976702 2:136485448-136485470 TGGTAGTTCATTTTGTAATTTGG - Intergenic
939243056 2:139587022-139587044 TTCTAGCTCTTTTTGTTAGTTGG - Intergenic
940228475 2:151425264-151425286 TTGTAGTTCTTTATATGTTTTGG + Intronic
940782829 2:157951527-157951549 TACAAGTTCTTTATATATTTTGG + Intronic
941238162 2:163001822-163001844 GTTGAGTTCTTTATGTATTTTGG - Intergenic
941262322 2:163313328-163313350 TTCAAGTTCATTTTGTATTTTGG - Intergenic
941264718 2:163347350-163347372 ATGTATTTCTTTATGTACTTGGG - Intergenic
941481303 2:166017727-166017749 TTCTAGTTCTTAATTAATTTTGG - Intronic
941516360 2:166485158-166485180 TTCTAGCACTTTATATAAATTGG - Intronic
941709318 2:168695348-168695370 TTCTTGCTTTTTATTTAATTTGG - Intronic
941727396 2:168877619-168877641 TTCTGTTTCTTGATTTAATTTGG - Intronic
942379585 2:175374606-175374628 TTCTGGTTCTTCATCTTATTGGG + Intergenic
943249377 2:185497199-185497221 TTCAAGTTATTTATTTATTTTGG - Intergenic
943348480 2:186769740-186769762 TTCTTTTTCTTTCTATAATTGGG - Intergenic
943443822 2:187957186-187957208 TTCTAGTTAGTTATTTATTTGGG - Intergenic
943889162 2:193264255-193264277 TTATTATTGTTTATGTAATTGGG + Intergenic
943986752 2:194631860-194631882 TTTGAGTTCCTTATGTATTTTGG - Intergenic
944275131 2:197828102-197828124 TTCTTTTTCTTTTTATAATTTGG + Intronic
944287450 2:197967562-197967584 TTATATTTCTTTATTTACTTTGG + Intronic
944399208 2:199305830-199305852 TTAAATTTCTTTAGGTAATTAGG - Intronic
944417589 2:199494265-199494287 TTCCTGTTCTTTTTTTAATTTGG - Intergenic
944576229 2:201093687-201093709 TTCCAGTTAGTTTTGTAATTTGG - Intergenic
944981779 2:205129052-205129074 TTCTAGTTCTATACTAAATTTGG + Intronic
945494126 2:210489500-210489522 GTCTAGTTTTATATGTAAGTAGG + Intronic
946768725 2:223065101-223065123 TTCTAGTTTTTTTCCTAATTTGG - Intronic
946839462 2:223805986-223806008 TTCTCTTTCTCTTTGTAATTTGG - Intronic
947249025 2:228080243-228080265 TTTGAGTTCTTTATATATTTTGG - Intronic
947726036 2:232401390-232401412 TTGTATTTTTTTATATAATTGGG + Intergenic
948490789 2:238311599-238311621 TTTGAGTTCTTTATATATTTTGG - Intergenic
948742355 2:240056288-240056310 TGCTAGTTGTTGATGGAATTTGG + Intergenic
1168982948 20:2023501-2023523 TTCTAATTCTTTCTTTAATGTGG - Intergenic
1169555935 20:6750101-6750123 TTTTAATTCTGTATGTAAATAGG - Intergenic
1169663162 20:8003134-8003156 TACTAGTTTTTTAAGTATTTAGG - Intronic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1169975165 20:11317173-11317195 TAGTAGTTCCTTATGTATTTTGG + Intergenic
1170160971 20:13310688-13310710 TTTGAGTTTTTTATGTATTTCGG - Intergenic
1170234852 20:14091118-14091140 TTTAAGTTCTTTATATATTTTGG + Intronic
1174241510 20:49139343-49139365 TTGTAGTTCTTTATATATTCTGG - Intronic
1174282200 20:49447341-49447363 TTCTTGTTCTTTCTGTAACCTGG - Intronic
1174469657 20:50747764-50747786 TTTTAGTTTATTATTTAATTAGG + Intronic
1174682281 20:52420304-52420326 TTCTTCCTCTTTATGTAATGTGG + Intergenic
1174839651 20:53889695-53889717 TTGTAGTTCTTTATATACTTTGG - Intergenic
1174927943 20:54781694-54781716 TTGTAGTTCTTTATATATTCAGG + Intergenic
1175470873 20:59226599-59226621 TTCTACATCTTTATATATTTCGG - Intronic
1176402879 21:6331257-6331279 TTCTAGTTGTTTTTTTAATATGG + Intergenic
1176434278 21:6657847-6657869 TTCTAGTTGTTTTTTTAATATGG - Intergenic
1176458540 21:6984917-6984939 TTCTAGTTGTTTTTTTAATATGG - Intergenic
1177067015 21:16451476-16451498 TACAAGCTCTTTCTGTAATTTGG + Intergenic
1177436067 21:21053959-21053981 CTCTACATCTTTATATAATTTGG + Intronic
1177679358 21:24344895-24344917 TTGAAGTTCTTTATATATTTTGG + Intergenic
1178474455 21:32924635-32924657 TTCGAGTTCTTTGTATATTTTGG + Intergenic
1178723502 21:35030844-35030866 TTTGAGTTCTTTATGTAGTTTGG - Intronic
1179148703 21:38792378-38792400 TTCTAGTTTTTTATTTAAAGTGG + Intergenic
1179504878 21:41833786-41833808 TTCTAGTACTTTGTTTTATTTGG + Intronic
1180196557 21:46199154-46199176 TTTTAGTTCTTCATATATTTTGG - Intronic
1180603968 22:17041542-17041564 TTCAAGTTCTTTATTTTCTTGGG + Intergenic
1182183499 22:28376501-28376523 TTATAGTTGTTTAAGTTATTAGG - Intronic
1183446028 22:37855870-37855892 TTCTATTTCCTTCTATAATTTGG + Intronic
949733445 3:7142612-7142634 TTATAGTTCTTGATGCAATTTGG + Intronic
949843543 3:8347822-8347844 TGAGAGTTCTTTATGTATTTTGG - Intergenic
950326741 3:12117599-12117621 TTCCAGTTCCTGATGTTATTTGG - Intronic
951567034 3:24020928-24020950 TTCTATTTATTTATTTATTTGGG + Intergenic
951988925 3:28653761-28653783 TTGGAATTCTTTATGTATTTTGG + Intergenic
952037486 3:29220492-29220514 TTCTATTTCAATATGTGATTTGG + Intergenic
952285802 3:31968767-31968789 TTATAGTTGTTTAGTTAATTTGG - Intronic
952461661 3:33533318-33533340 TTCTACATCCTTATGCAATTTGG + Intronic
953082900 3:39637426-39637448 TTCTAGGTATTTGTGTGATTTGG - Intergenic
953580573 3:44151308-44151330 TGAGAGTTCTTTATGTATTTTGG + Intergenic
953773822 3:45798951-45798973 TTGTAGTTCTTTATGTATTCTGG + Intergenic
953965914 3:47307001-47307023 TTGGAGTTCTTTATGTACTCTGG + Intronic
955619560 3:60847881-60847903 TTCAAGTTCTTTATTTCATTTGG - Intronic
956374766 3:68602886-68602908 TTTGAGTTCCTTATATAATTTGG + Intergenic
957115253 3:76015691-76015713 TTCTAGTTCTTTCTGTGCATTGG + Intronic
957175064 3:76797506-76797528 TTCTAGTTCCTTATGATGTTAGG - Intronic
957630197 3:82707940-82707962 TTTGAGTTCCTTATGTATTTTGG + Intergenic
957691583 3:83577637-83577659 TTATAGTGCATTATGTGATTTGG + Intergenic
957731900 3:84150032-84150054 TTGTGGTTCATTATGTATTTTGG + Intergenic
957736036 3:84203903-84203925 TTCAAGTTCTTTATGTATTCTGG - Intergenic
958193282 3:90210567-90210589 TTTTAAATTTTTATGTAATTAGG - Intergenic
958416587 3:93881511-93881533 TTTTAAATTTTTATGTAATTAGG - Intronic
958475979 3:94583501-94583523 TTTTAGTTGTTTTTGTAACTTGG - Intergenic
958863638 3:99473910-99473932 TTTTAGTTATTTATGTATTCTGG + Intergenic
959322909 3:104901699-104901721 TAATATTTCTTTATGTATTTAGG + Intergenic
959476235 3:106815409-106815431 TTCAAGTTCTATATATTATTGGG + Intergenic
960498437 3:118405736-118405758 ATCTAGTTATTTTGGTAATTGGG + Intergenic
960857211 3:122114359-122114381 TTCTAGTTGTTTATGGAAAGAGG - Intronic
961073368 3:123959179-123959201 ATATAGTTCTATATTTAATTTGG + Intronic
963615646 3:147534052-147534074 TTCTAGAACTTTATATAAGTGGG + Intergenic
964063151 3:152549934-152549956 TTTTAGTTCTTTATATAAAATGG + Intergenic
964171637 3:153777431-153777453 TTCTAGATCTTTATATATCTTGG + Intergenic
964611029 3:158615167-158615189 TTTGAGTTCCTTATGTATTTGGG + Intergenic
964913472 3:161810949-161810971 GTCTATTTCTTTATTTATTTAGG + Intergenic
965216483 3:165870651-165870673 TTTTGGTTCTATATGTATTTTGG + Intergenic
965495718 3:169396665-169396687 TTCTAATTCTTAATATAACTTGG - Intronic
965764532 3:172115961-172115983 TGCTGGTTCTGGATGTAATTAGG + Intronic
966341993 3:178935418-178935440 TTTGAGTTCTTTATATATTTTGG + Intergenic
966391562 3:179458205-179458227 TTTTAGTTCTTAATGTGATGTGG + Intergenic
966419254 3:179721272-179721294 GTTTATTTCTCTATGTAATTGGG + Intronic
966725543 3:183104597-183104619 TTATAGTTCTTTATATATTAAGG - Intronic
967577076 3:191106859-191106881 TTATAGTTCTGTATGTACCTGGG - Intergenic
1202736938 3_GL000221v1_random:11064-11086 ATCTGGTAATTTATGTAATTCGG + Intergenic
968527207 4:1066667-1066689 TTTTAGTTCTTTATGTATTCTGG + Intronic
969386690 4:6854902-6854924 TTCTAATGGTTTATATAATTGGG + Intronic
970148258 4:13059994-13060016 TTTGAGTTTTTTATGTATTTTGG + Intergenic
971812839 4:31449609-31449631 TTTAAGTTTTTTATGTATTTTGG + Intergenic
971901236 4:32660834-32660856 TGCTACTTAATTATGTAATTTGG + Intergenic
972128240 4:35797746-35797768 TTTGAGTTCTTTATATATTTTGG - Intergenic
972409761 4:38781737-38781759 TTCTATTTCTTTATATCATTGGG - Intronic
973033753 4:45379046-45379068 TTGTAGATGTTTATGTAAATTGG + Intergenic
973161744 4:47026702-47026724 TACAAATTCTTTACGTAATTTGG + Intronic
973182056 4:47281164-47281186 TTTGAGTTCTTTATATATTTTGG - Intronic
973212255 4:47629412-47629434 TTTTAGTTCCTTATGTATTTTGG + Intronic
973223835 4:47759481-47759503 TTTGAGTTCCTTATGTATTTTGG - Intronic
973313953 4:48740240-48740262 TAAGAGTTCTTTATGTATTTTGG - Intronic
973626268 4:52775688-52775710 ATCTTGTTTTTCATGTAATTTGG + Intergenic
973935091 4:55837803-55837825 TTCTTTTTCTTTATCTACTTGGG - Intergenic
974801078 4:66818890-66818912 TTCGAGTTTCTTATGTACTTTGG - Intergenic
974887596 4:67839631-67839653 TTCTAGTTCATGCTGTTATTGGG - Intronic
975339960 4:73228030-73228052 TTCTAGTAGTTTATGTGAGTGGG - Intronic
975471015 4:74768217-74768239 TGAGAGTTCTTTATGTATTTTGG - Intronic
975853181 4:78594743-78594765 TAAGAGTTCTTTATGTATTTTGG + Intronic
976349733 4:84047771-84047793 TTCTGCTTCTTTGTCTAATTTGG - Intergenic
976432053 4:84973570-84973592 TTATAGTTTTTTATGTTATGTGG + Intergenic
976532969 4:86177058-86177080 TTTTAGTTTTTCATGTAATGGGG - Intronic
977228200 4:94419302-94419324 TTCTAGAAATTTATGTAATTTGG - Intergenic
977405452 4:96591849-96591871 TCCTATTTTTTTATGTAAATAGG + Intergenic
977412146 4:96680638-96680660 TTCTAATTCTTTATTTCATCAGG + Intergenic
977853754 4:101862114-101862136 TTTTAGTCCTTTATATAACTTGG - Intronic
978104069 4:104880495-104880517 TTCTAGAATTTTATCTAATTAGG - Intergenic
978214124 4:106177212-106177234 TTTGAGTTCTTTATGTACTCTGG + Intronic
978225622 4:106331147-106331169 CTCTAGTTCATTCTGTCATTTGG + Intronic
978267216 4:106840686-106840708 TTCTATTTCTTTATTTCCTTAGG + Intergenic
978499911 4:109398397-109398419 TTCTAAATCTGTATGTATTTTGG - Intergenic
978832180 4:113101692-113101714 TTCTAGTAATATAGGTAATTGGG - Intronic
979282494 4:118883282-118883304 TTCTAGTTCTTTGAATAATTAGG + Intronic
979371324 4:119890696-119890718 TTCTAGGGATTTATGTCATTAGG + Intergenic
979837100 4:125384528-125384550 TATTAGTTCTTTATATATTTTGG + Intronic
979991706 4:127381884-127381906 TTAGAGTTCTTTACATAATTTGG + Intergenic
980567194 4:134559119-134559141 TTCTAAGTTATTATGTAATTTGG - Intergenic
981313865 4:143322666-143322688 GTATAGTTCTTTATGTATTTTGG + Intergenic
981908093 4:149945910-149945932 TTCTATTTCTTTTGATAATTTGG - Intergenic
982111207 4:152056500-152056522 TTTTAGTTCTTTGTATATTTTGG + Intergenic
983142105 4:164163166-164163188 TTTTAGTTCTTCCTGTATTTAGG - Intronic
983352455 4:166609157-166609179 TTTTAGTTCTTTGTATATTTTGG - Intergenic
983752234 4:171289301-171289323 TTCTTGTTCTTTATTTAAAGGGG - Intergenic
984577899 4:181472691-181472713 TTCTTGTTCTTTGAGTTATTTGG + Intergenic
984680013 4:182596527-182596549 TTTTAGATCTTAAAGTAATTTGG + Intronic
984729022 4:183048721-183048743 TTCTATTTATTTTTGTAACTTGG + Intergenic
984882640 4:184424138-184424160 TCCTATTTCTTTTTGTCATTGGG + Intronic
985183782 4:187294650-187294672 TGGTAGTTCATTTTGTAATTTGG - Intergenic
985242101 4:187941288-187941310 TTTTAGTTCATCATGAAATTAGG - Intergenic
985791919 5:1933406-1933428 TTCTAGTTTTTTTTGTTATAAGG - Intergenic
986192110 5:5507205-5507227 TAGAAGTTCTTCATGTAATTTGG - Intergenic
986613315 5:9591517-9591539 TTGTAGTTCTTTATATATTCTGG - Intergenic
986771892 5:10981667-10981689 TTTCAGTTCTTTATGTATGTTGG + Intronic
986794435 5:11194995-11195017 TTGTATTTTCTTATGTAATTTGG - Intronic
986903028 5:12460426-12460448 TTCTAGGTCTTTATGGATTAAGG - Intergenic
987492874 5:18602894-18602916 TTCTATTTATTTTTGTAACTGGG + Intergenic
987638752 5:20583124-20583146 TTTTACTTCTTCATGTTATTTGG - Intergenic
988329859 5:29822021-29822043 TTATATTATTTTATGTAATTTGG + Intergenic
988575580 5:32420539-32420561 TTAAATTTCTTTCTGTAATTGGG - Intronic
988873851 5:35421722-35421744 TTTGAGTTCCTTATGTACTTTGG - Intergenic
989148958 5:38278984-38279006 TTTTAGTTCCTTATATATTTTGG - Intronic
989560106 5:42840781-42840803 TTCTAGTTCTTTTTCAAAGTGGG + Intronic
989685951 5:44087496-44087518 TTATAGTTCTTAAAATAATTTGG + Intergenic
991005842 5:61827262-61827284 TTCAAGTTAATTATGTAAATGGG + Intergenic
991557597 5:67913046-67913068 TTCTTGTTCTTTCTGTGTTTTGG + Intergenic
991622729 5:68562268-68562290 TTCTAGTTGTTTATGGGTTTTGG - Intergenic
992020078 5:72614232-72614254 GTCAAGTTCCTTATGTATTTTGG + Intergenic
992637774 5:78741611-78741633 TTGTAATTTTTTATTTAATTTGG - Intronic
992766595 5:80006561-80006583 CTCTAGTTCTTTTTGGAACTAGG + Intronic
993196463 5:84753703-84753725 TTCTAATTCTTTATGTTTTATGG - Intergenic
993391988 5:87329739-87329761 TTCTACTGCTTTAAGTAATGAGG + Intronic
993394390 5:87365301-87365323 TTCTAATTCATTATTTTATTGGG + Intronic
993986086 5:94599759-94599781 TACTAGTGCTTTATGTATTCTGG - Intronic
994311287 5:98274370-98274392 TTTGAGTTCTTTATATATTTTGG - Intergenic
994425134 5:99576117-99576139 TTCTCTTTCTTTATGCAAATGGG - Intergenic
994436205 5:99736116-99736138 TTCTCTTTCTTTATGCAAATGGG + Intergenic
994916401 5:105985370-105985392 GTGTATTTCTTTATTTAATTAGG - Intergenic
994930024 5:106170489-106170511 TTCTATTTTATCATGTAATTAGG - Intergenic
994954133 5:106505979-106506001 TTTAAGTTCCTTATATAATTTGG - Intergenic
995405471 5:111790244-111790266 TTCTTGTTTTTCATGTATTTAGG - Intronic
995470433 5:112496258-112496280 TTCTAGTTGTTTATGGAAGGTGG - Intergenic
995754159 5:115484820-115484842 TTTTAGTTCCTTATATATTTTGG + Intergenic
996078683 5:119229974-119229996 TTTTAGTATTTTATGTAATTTGG + Intronic
996185476 5:120468370-120468392 TTCTTTTTCTTAATGTAAATAGG + Intronic
996599705 5:125247927-125247949 TTTGAGTTCTTTATATATTTTGG + Intergenic
996951420 5:129130705-129130727 ATTGAGTTCTTTATGTATTTTGG + Intergenic
996994923 5:129684371-129684393 TTCTAACTCTTTATGGATTTTGG - Intronic
997151193 5:131497242-131497264 TAAAAGTTCTTTATGTATTTTGG + Intronic
997742181 5:136265728-136265750 TTCTTGTTATTTGTGTAAGTGGG - Intronic
997861075 5:137416998-137417020 TAATATTTCTTTATGTATTTTGG + Intronic
997936856 5:138119859-138119881 TACAAGTTCTTTATATTATTTGG + Intronic
997959839 5:138311823-138311845 TTGTAGTTCTTTATATATTCTGG - Intronic
998584685 5:143414714-143414736 TTCAAGTTCTTTCTGGAATTAGG + Intronic
998668553 5:144327218-144327240 TTCTAGTGATCTATGGAATTTGG + Intronic
999469956 5:151845337-151845359 TAATAGTTCTTTATGTATTCTGG - Intronic
999530679 5:152460248-152460270 TTATAGTTATGAATGTAATTAGG - Intergenic
1000101274 5:158019156-158019178 TTCTAGTTCTTTATGTGCTAGGG + Intergenic
1000543782 5:162573489-162573511 TTCTAGTTTTTCAAATAATTAGG - Intergenic
1000638743 5:163675721-163675743 TTTGAGTTCTTTATATATTTTGG - Intergenic
1000778656 5:165451527-165451549 TTCTAGTATTTTATGTAAAATGG + Intergenic
1000813753 5:165894047-165894069 ATTTAGTTCTTCATGAAATTGGG - Intergenic
1001108231 5:168873865-168873887 TTCTGATTCTTTATCTTATTGGG - Intronic
1001778737 5:174349327-174349349 TACTTGTTCTTTTTTTAATTGGG + Intergenic
1002834993 6:858334-858356 TGCCAGTTCTTTTCGTAATTTGG - Intergenic
1002951980 6:1822930-1822952 TTCTATTGCATTTTGTAATTTGG - Intronic
1003789674 6:9530806-9530828 TTCTTTTTCCTTATCTAATTTGG - Intergenic
1003854383 6:10258129-10258151 TAATAGTTCTTCATGTATTTTGG - Intergenic
1004711325 6:18173387-18173409 TTGTAGTTCTTTATGTAATCTGG + Intronic
1004862613 6:19820570-19820592 TTGGAGTTCTAAATGTAATTTGG + Intergenic
1004964094 6:20827845-20827867 TTTTAGTTTTTTTTTTAATTGGG + Intronic
1005403640 6:25462042-25462064 TGATAGTTCTTTATGCATTTTGG + Intronic
1005839171 6:29729767-29729789 TCATAGTTCTTTATGTATTCTGG - Intronic
1005853062 6:29837138-29837160 TTGTAGTTCTGTATGTAGTCTGG - Intergenic
1006566631 6:34963990-34964012 TTTGAGTTCTTTATATATTTTGG + Intronic
1007233753 6:40374885-40374907 TTCTAGTTTATTATATACTTAGG - Intergenic
1008627503 6:53332179-53332201 TTCTAGTTATTGATGTAGTTTGG - Intronic
1008905679 6:56675520-56675542 TTTTAGTTCCTTATATATTTTGG - Intronic
1008967445 6:57327338-57327360 TTCTACTTTTTTATTTTATTTGG - Intronic
1009409908 6:63354264-63354286 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1009496913 6:64360720-64360742 TTCTATTTCTATATGCAGTTGGG + Intronic
1009799152 6:68511326-68511348 TTGTTGTTCTTTCTGTAATGTGG + Intergenic
1009804650 6:68587720-68587742 TTTAAGTTCCTTATGTAATTTGG - Intergenic
1010225878 6:73488491-73488513 TTGTAGTTCTTTATGTATACTGG + Intronic
1010292038 6:74148407-74148429 TTCTGTTTCTTTATATAATGAGG + Intergenic
1010627003 6:78150049-78150071 TTTGTGTTCTTTATGTATTTTGG - Intergenic
1010649170 6:78430828-78430850 TTTGAGTTCATTGTGTAATTTGG + Intergenic
1010885582 6:81235331-81235353 TTTGAGTTCTTTATATATTTGGG + Intergenic
1010911379 6:81561406-81561428 TTCTGTTACTTTATCTAATTTGG - Intronic
1011252273 6:85384493-85384515 TTCTACTCCTTGATGTATTTGGG - Intergenic
1011390922 6:86852450-86852472 TTCTGGTTCTTTGTGTAAGCAGG + Intergenic
1011423388 6:87199359-87199381 TAGTAGTTCTTTATGTATTCTGG + Intronic
1011579665 6:88846345-88846367 ACTTAGTTCTTTATGTAATAAGG - Intronic
1011580973 6:88864294-88864316 TTCAACTTCATTTTGTAATTGGG + Intronic
1011583030 6:88892736-88892758 TTCTAGCTGTTAATGTAATTAGG + Intronic
1011882468 6:92047042-92047064 TTTTAATTATTTATTTAATTAGG - Intergenic
1012103713 6:95125590-95125612 TTCTAGGACTTTATTTCATTTGG - Intergenic
1012136884 6:95568831-95568853 TGCAAGTTCTCTTTGTAATTCGG + Intergenic
1012198163 6:96370941-96370963 TTGCATTTCTTTATGTGATTGGG - Intergenic
1012654574 6:101799390-101799412 TACTAGGACTATATGTAATTGGG + Intronic
1013954581 6:115826066-115826088 TTCTACTTCTTCATGTCTTTTGG - Intergenic
1013984413 6:116172741-116172763 TTATATTTCTTTATGTACTCAGG + Intronic
1014399490 6:120969982-120970004 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1014431741 6:121379302-121379324 TTTTACTTCTTTATATATTTTGG + Intergenic
1014508996 6:122297251-122297273 TTCTAGTTTTTTATTTAAAATGG + Intergenic
1014903032 6:126991537-126991559 TTCTTGTTATCTATGAAATTTGG + Intergenic
1015618285 6:135102518-135102540 TTGTAGTTCTTTATATATTCTGG + Intronic
1015899985 6:138054400-138054422 TTCTTTGTCTTTATCTAATTGGG - Intergenic
1016189344 6:141243447-141243469 TTTAAGTACTTTATGTACTTAGG - Intergenic
1016687591 6:146899262-146899284 TTGTAGTTGTGTATGTAACTTGG + Intergenic
1016708236 6:147138847-147138869 TTCTAGTTCTTTATCTTCTTTGG - Intergenic
1016770463 6:147844112-147844134 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1016855048 6:148659538-148659560 TTGGAGTTCCTTATGTATTTTGG - Intergenic
1017314945 6:153020008-153020030 TTCTAGTTTTTTTTTTAGTTTGG + Intronic
1017437667 6:154432389-154432411 TTCTTGTTCTTTGTATATTTTGG + Intronic
1018410885 6:163546874-163546896 ATCTACTTATTTATATAATTTGG - Intronic
1019582583 7:1773285-1773307 TTTGAGTTCCTTATGTATTTTGG + Intergenic
1020609902 7:10382496-10382518 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1020770447 7:12385839-12385861 TTCAAGTCCTCTAAGTAATTAGG - Intronic
1022016405 7:26352777-26352799 TTCTAATTCTCTATTTAATTAGG + Intronic
1022072384 7:26929694-26929716 TTATAGCTTTATATGTAATTTGG - Intronic
1022450097 7:30505981-30506003 TTATAGTTTTTTTTTTAATTTGG - Intronic
1022758096 7:33316182-33316204 TTCTAAAACTTTATGTAAGTGGG + Intronic
1023751949 7:43381213-43381235 TTGTAGTTCTTTATATATTCTGG + Intronic
1024625507 7:51205834-51205856 TTTGAGTTCTTTATCTATTTTGG - Intronic
1024755327 7:52523002-52523024 CTCTTGTTTTTTATGTAAGTAGG + Intergenic
1024793197 7:52990712-52990734 TTTTTCTTCATTATGTAATTGGG + Intergenic
1026540986 7:71279840-71279862 TTGATGTTCTTTATGTTATTTGG + Intronic
1026709152 7:72721741-72721763 TTCTAGTTCTTTGGGTTTTTTGG + Intronic
1027401994 7:77818738-77818760 TTGTAGTTCCATATGTATTTTGG + Intronic
1027473401 7:78600159-78600181 GTTTAATTCTTTATGTATTTAGG - Intronic
1027490935 7:78825336-78825358 TGGTAGTTCATTTTGTAATTTGG - Intronic
1028549899 7:92048899-92048921 TTCTAGTTCATTGTGATATTGGG + Intronic
1028567642 7:92250062-92250084 TACTAGTACCTTATGAAATTAGG - Intronic
1028876675 7:95831864-95831886 TTTCAGTTCTTTATATATTTTGG + Intronic
1028957211 7:96706957-96706979 TTCAAGTTCTTTCTGTACTTTGG - Intronic
1029029514 7:97453136-97453158 TTGTAATCCTTTGTGTAATTAGG - Intergenic
1029992347 7:104973885-104973907 TTCTAGATCTTTTTGTAAAAAGG + Intergenic
1030323666 7:108196452-108196474 TTTGAGTTCTTTATATATTTTGG - Intronic
1030578865 7:111326787-111326809 TGGTAGTTCTTTTTATAATTTGG - Intronic
1030729554 7:112969985-112970007 CTCTAGTTATTTATAAAATTTGG + Intergenic
1030790587 7:113722789-113722811 TTCTCTTTCTTTATTTATTTTGG + Intergenic
1030790680 7:113724170-113724192 TACTATTTCTTTATTTTATTGGG + Intergenic
1030988033 7:116265148-116265170 TTCAAATTCTTTGTGGAATTTGG + Intergenic
1031200682 7:118681085-118681107 TTGTATTTATTTGTGTAATTTGG - Intergenic
1031273246 7:119682117-119682139 TTCTTCTTCTTTATTTAAGTAGG + Intergenic
1031418737 7:121524080-121524102 TTCTCGTTGTTTATGGAATTAGG - Intergenic
1031857988 7:126944748-126944770 TGTAAGTTCTTTATGTATTTTGG - Intronic
1031902102 7:127422384-127422406 TTGTGGTTCTATATGTATTTTGG - Intronic
1031909185 7:127496565-127496587 TTTTAGTTCTTTATATGTTTTGG - Intergenic
1032145830 7:129379601-129379623 TTCTTTTTCTTTATATAACTAGG + Intronic
1032690414 7:134280841-134280863 TTCTATTTCATTATTAAATTGGG + Intergenic
1033493291 7:141865985-141866007 TTCTATTTCTTAATATAATATGG + Intergenic
1033638133 7:143232072-143232094 TTCTAGTGCTTTATAGCATTGGG - Intergenic
1033656430 7:143378091-143378113 TTATAGTTGTTGATGTTATTAGG + Intergenic
1034058570 7:148064219-148064241 TTTTAGTTCTGTATGAATTTAGG + Intronic
1034072109 7:148196338-148196360 TTCTAGTTCCTTGTGTAGTCAGG + Intronic
1034153534 7:148935878-148935900 TTCAAGTCCTTTATATAAATTGG + Intergenic
1034184192 7:149161840-149161862 TTCTAATTCTTGCTGTATTTGGG - Intronic
1034539748 7:151749585-151749607 TTGTAGTTCTTTATGTATTCTGG - Intronic
1034565153 7:151908258-151908280 TTCTATTTCTTTCTTTCATTTGG + Intergenic
1035110517 7:156478123-156478145 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1035195925 7:157220319-157220341 TTCTAGTTTTTTTTTCAATTTGG - Intronic
1035364944 7:158343176-158343198 TTGTGGTTCTTTATGTATTTTGG - Intronic
1035452990 7:158990872-158990894 TAAGAGTTCTTTATGTATTTTGG - Intergenic
1036064727 8:5367118-5367140 TTAAAGTTCTTTATATATTTTGG - Intergenic
1036287403 8:7456031-7456053 TTTTATTTATTTATGTATTTTGG + Intronic
1036334077 8:7855494-7855516 TTTTATTTATTTATGTATTTTGG - Intronic
1036473424 8:9071507-9071529 TTTTATTTCTTTTCGTAATTAGG - Intronic
1036541806 8:9721441-9721463 TTCTAGTTCATTTTGTCAGTAGG - Intronic
1037706357 8:21318733-21318755 TTATAGTTCTTTATATATTCTGG + Intergenic
1037874387 8:22533437-22533459 TTATAGTTCTTTATATATTCTGG - Intronic
1038012723 8:23487548-23487570 TTGTAGTTATTTTTGTAATGGGG - Intergenic
1038132068 8:24743767-24743789 TTCTGGTTCTTGCTGTATTTTGG + Intergenic
1038227166 8:25668041-25668063 TTCCATTTCTTTTTGCAATTTGG + Intergenic
1038324160 8:26559614-26559636 TCTTAGTTCTTTAAGTAATTTGG + Intronic
1038572541 8:28675265-28675287 TTCTAGTTATTTATACATTTTGG - Intronic
1039463933 8:37769485-37769507 TTGTAGCTCTTTATGTATTCTGG - Intronic
1039495915 8:37979980-37980002 TTCTATTTATTTATTTATTTTGG - Intergenic
1039773046 8:40708000-40708022 TTCTAGTTCTATTTTTATTTGGG - Intronic
1039853095 8:41388322-41388344 TAAGAGTTCTTTATGTATTTTGG - Intergenic
1039924967 8:41921598-41921620 TAAGAGTTCTTTATGTATTTTGG - Intergenic
1040011983 8:42669109-42669131 TTGTAGTTCTTTTTGTCCTTAGG + Intergenic
1040749153 8:50684159-50684181 TACTACTTGTTTATGTAAGTGGG - Intronic
1040767841 8:50937155-50937177 TTTAAGTTCTTTGTGTATTTTGG - Intergenic
1041144979 8:54865643-54865665 TTCTAGTACTCTGAGTAATTAGG + Intergenic
1041509422 8:58638890-58638912 TTCGAGTTTTTTATGTATTTTGG - Intronic
1041519137 8:58735689-58735711 TTTGAGTTCCTTATGTATTTTGG - Intergenic
1041597670 8:59676056-59676078 TTCCAGTTCTTTGTGTTAATAGG + Intergenic
1042408081 8:68429172-68429194 TTGAAGTTCTTTGTGTATTTTGG - Intronic
1042488641 8:69374807-69374829 ATTTATTTATTTATGTAATTGGG - Intergenic
1043103437 8:76077897-76077919 TAATAGTTCTATATGTCATTAGG - Intergenic
1043265464 8:78262138-78262160 TTCTATTTCTATATCTAATTGGG + Intergenic
1043555354 8:81424130-81424152 TTTTATTTCTTAATGTAATTTGG - Intergenic
1043585285 8:81761293-81761315 TTATATTTCTTTAAGTATTTAGG - Intergenic
1043649420 8:82571392-82571414 ATCTATTTTTATATGTAATTTGG - Intergenic
1043683634 8:83062718-83062740 TTCTAGTTCTGTATATGACTAGG - Intergenic
1043821063 8:84865160-84865182 TTATAGTACTTTTTATAATTAGG + Intronic
1044099101 8:88108507-88108529 TTTTTCTTCTTTATGTAATATGG + Intronic
1044872690 8:96635249-96635271 TTGTAGTTCTTTATATATTCTGG + Intergenic
1045520842 8:102901604-102901626 TTGTAGTTCCTTATGTATTATGG - Intronic
1045952933 8:107872149-107872171 TAATAGTTCTTTATGTAGTCTGG - Intergenic
1046281135 8:112033433-112033455 TTTCAGTTCTTTATATATTTTGG - Intergenic
1046652110 8:116847490-116847512 TTCTAGCTCCTTATATAATATGG + Exonic
1047233432 8:123017367-123017389 TTCTATTTTATTATGTACTTTGG - Intronic
1047243093 8:123111790-123111812 TTATAGTTCTTTTTGTCCTTAGG + Intronic
1047259989 8:123247304-123247326 TTTTAGTTCTTTATATATTCTGG - Intronic
1047475475 8:125224184-125224206 TTTGAGTTCCTTATGTATTTTGG + Intronic
1047523816 8:125615687-125615709 TTCTAGTTCATTGTGTTATGCGG + Intergenic
1048350022 8:133608494-133608516 TTCTGGTTCCTTCTGTATTTTGG + Intergenic
1048382221 8:133875899-133875921 TTGTAGTTCTTTATGTGTTCTGG + Intergenic
1048480384 8:134785235-134785257 AAGTAGTCCTTTATGTAATTTGG + Intergenic
1048722126 8:137337418-137337440 TCAGAGTTCTTTAAGTAATTGGG + Intergenic
1049280777 8:141743100-141743122 TTGTAGTTCTTCATGCATTTTGG - Intergenic
1050126906 9:2366901-2366923 TTCTAGTTCTTTATAAATTCTGG - Intergenic
1050933864 9:11367437-11367459 ACCTAGTTCTATATATAATTTGG + Intergenic
1051512440 9:17893515-17893537 TGCTAGTGCTTTATGTACTGAGG - Intergenic
1051875814 9:21792084-21792106 TTTTAGTTCCTTATATATTTTGG - Intergenic
1051983591 9:23055181-23055203 TAGTAGTTCCTTATGTATTTTGG - Intergenic
1052583897 9:30398858-30398880 TTTGAGTTCCTTATGTATTTAGG - Intergenic
1052671887 9:31568473-31568495 TTATAGTTCTTTATATGTTTTGG - Intergenic
1053399517 9:37805515-37805537 TTCTAAGTTTTTATGTATTTGGG + Intronic
1053448967 9:38177333-38177355 TTCAAGTTCCTTATCTAATATGG + Intergenic
1053727718 9:41021290-41021312 TCCTTGTTGTTTATGTCATTTGG + Intergenic
1054700798 9:68410816-68410838 TCCTTGTTGTTTATGTCATTTGG - Intronic
1055155672 9:73060088-73060110 TTTTATTTTTTTATGTATTTTGG - Intronic
1055262814 9:74458453-74458475 TTGTAGTTCTTTATATATTGTGG - Intergenic
1056033538 9:82579870-82579892 TTGTAGTTCTTTATATATTCTGG - Intergenic
1056130019 9:83575255-83575277 TTCTAGTTCATTATCGAAATTGG - Intergenic
1056324860 9:85468342-85468364 TTCTTGTTCTTAATTTAATGTGG - Intergenic
1056871238 9:90282187-90282209 TTGAAGTTCTTTATGTATTCTGG - Intergenic
1058382783 9:104396152-104396174 TTTGAGTTCCTTATGTATTTTGG + Intergenic
1058408147 9:104700458-104700480 TTCTAGTTATTTATTAATTTGGG - Intergenic
1059806844 9:117810485-117810507 TTCTCTTTCTTTCTGTAATCTGG - Intergenic
1059817653 9:117935781-117935803 ATCTAGCTCTTGATGTCATTCGG - Intergenic
1062728545 9:138094670-138094692 TTCTAGTACATTTTGAAATTGGG - Intronic
1185860747 X:3577018-3577040 TTCAAGTTTTTTGTGCAATTGGG + Intergenic
1186335826 X:8586605-8586627 TCATAATTCTTTAAGTAATTTGG + Intronic
1187005191 X:15225861-15225883 TTCAAGTTCCTTATTTAAATAGG + Intergenic
1188333684 X:28901886-28901908 ATCTAACTCTTTAAGTAATTTGG + Intronic
1188428691 X:30079971-30079993 TAGGAGTTCTTTATGTAATTTGG + Intergenic
1188453078 X:30329719-30329741 TACAACTTCTTTATGTATTTTGG + Intergenic
1188517564 X:31003865-31003887 TTTTTATTCTTTATGTGATTAGG + Intergenic
1188577293 X:31667014-31667036 TTCTGGTTCTTAATGTATTCAGG + Intronic
1188929265 X:36086399-36086421 TTATAATTGTTTATGTAATATGG + Intronic
1189013795 X:37074709-37074731 TTTTAGTTCCTTATATATTTTGG - Intergenic
1189524348 X:41803996-41804018 TTCTGGTTCTTTATATGGTTGGG - Intronic
1189855662 X:45222873-45222895 TTTGAGTTCCTTATGTATTTTGG + Intergenic
1191920508 X:66251568-66251590 TAAGAGTTCTTTATGTATTTTGG + Intronic
1192310284 X:70006645-70006667 TAAGAGTTCTTTATGTATTTTGG + Intronic
1192404682 X:70872599-70872621 TTCTAGTGCTTTAGCTAAATGGG - Intronic
1192658513 X:73018186-73018208 GACTAGTTCCTTATGTATTTTGG + Intergenic
1193390214 X:80917570-80917592 TTGGAGTTCTTTATGAATTTTGG - Intergenic
1193778478 X:85673428-85673450 TTCGAGTTCCTTATATATTTTGG + Intergenic
1194016869 X:88633270-88633292 TTCTAGTTCTTTAAGATGTTGGG - Intergenic
1194182321 X:90728150-90728172 TTGTAGTTTTTTATATATTTTGG - Intergenic
1194437894 X:93892180-93892202 TGCTTGTTTTTTATGTAAATAGG - Intergenic
1194531330 X:95053091-95053113 TTTGAGTTCTTTACGTATTTTGG - Intergenic
1194817237 X:98458126-98458148 TTTGAGTTCCTTATATAATTTGG + Intergenic
1196346502 X:114666078-114666100 TTCTGGTTCTAGATATAATTTGG - Intronic
1196383124 X:115115822-115115844 TTGTAGTTCCTTATGTATTCTGG - Intronic
1196506468 X:116450273-116450295 TTAAAATTCTTGATGTAATTTGG - Intronic
1197124612 X:122929742-122929764 TTCTAGTTGTTTATTTAAAACGG + Intergenic
1197188174 X:123611793-123611815 TAAGAGTTCTTTATGTACTTTGG - Intronic
1197430111 X:126352127-126352149 TTCCAGTAATTTATGTATTTTGG + Intergenic
1197679360 X:129365874-129365896 TTATATTTCTATATGTTATTGGG - Intergenic
1197913074 X:131506473-131506495 TTCTATTTCTTGATGTAGTATGG - Intergenic
1197988366 X:132291142-132291164 TTCTGGTTCTATATGAATTTAGG + Intergenic
1199030412 X:142991891-142991913 TACTATTTATTTATCTAATTTGG + Intergenic
1199178788 X:144827346-144827368 TTTTAGTTATTTTTGTTATTTGG - Intergenic
1199337421 X:146635610-146635632 TTATAGTTCTTTATATATTCTGG - Intergenic
1199792165 X:151165631-151165653 TTTTACTTCTTTTTTTAATTTGG - Intergenic
1199857969 X:151775916-151775938 TTCTACTTCTTTTTCTTATTTGG + Intergenic
1200528944 Y:4310104-4310126 TTGTAGTTTTTTATATATTTTGG - Intergenic
1200859991 Y:7980720-7980742 TTATAATTCTTTATGAATTTTGG - Intergenic
1200906485 Y:8488416-8488438 TTATAATTCTTTATGAATTTTGG + Intergenic
1201055643 Y:9987638-9987660 TTCTAGTTTTTTATGGGTTTAGG - Intergenic
1201568973 Y:15394334-15394356 TTTTTGTCCTTTTTGTAATTAGG - Intergenic