ID: 903410711

View in Genome Browser
Species Human (GRCh38)
Location 1:23140974-23140996
Sequence CAGTGTGCCCAGGGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 9, 3: 103, 4: 556}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903410701_903410711 20 Left 903410701 1:23140931-23140953 CCAATCCAATGCTCAAGCACCTC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG 0: 1
1: 0
2: 9
3: 103
4: 556
903410705_903410711 1 Left 903410705 1:23140950-23140972 CCTCACAGGCTGGCTCCTTAGCC 0: 1
1: 0
2: 3
3: 15
4: 281
Right 903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG 0: 1
1: 0
2: 9
3: 103
4: 556
903410700_903410711 21 Left 903410700 1:23140930-23140952 CCCAATCCAATGCTCAAGCACCT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG 0: 1
1: 0
2: 9
3: 103
4: 556
903410702_903410711 15 Left 903410702 1:23140936-23140958 CCAATGCTCAAGCACCTCACAGG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG 0: 1
1: 0
2: 9
3: 103
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903410711 Original CRISPR CAGTGTGCCCAGGGAGAAGG TGG Intronic
900179862 1:1306328-1306350 CGGAGGGGCCAGGGAGAAGGTGG + Intronic
900340817 1:2188255-2188277 CTGTGAGCCCAGGCAGACGGTGG + Intronic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
900800881 1:4736324-4736346 CAGGAGGCCAAGGGAGAAGGCGG - Intronic
901025305 1:6275982-6276004 CAGTGTGCCCAGGAAGCAGTGGG + Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901679797 1:10906397-10906419 CAGTGGGCTCAGGGAGAGGAAGG - Intergenic
901916468 1:12504263-12504285 CAGTGACCCCAGGGACCAGGTGG - Intronic
902280016 1:15367536-15367558 GAGTGTGCTCAAGGAGAAGATGG + Exonic
902336375 1:15757267-15757289 CTGTGTGCCCAGGGACACAGCGG + Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902895803 1:19479275-19479297 CAGTCTGCTGAGGGAGATGGTGG - Intronic
903071608 1:20729590-20729612 CGGTGTGGCCAAGGACAAGGAGG - Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903607398 1:24584950-24584972 CTGTGTGCCCAGTGAGTGGGTGG + Intronic
904812636 1:33173260-33173282 CAGTGTGCCAGGGGAGCTGGTGG - Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
906515937 1:46438802-46438824 CAGGGAGCACAGGGAGTAGGAGG + Intergenic
906520338 1:46463226-46463248 CTATGTGTCCAAGGAGAAGGAGG - Intergenic
907414272 1:54303370-54303392 CAGTCAGCCCAGGGGGCAGGGGG + Intronic
908477661 1:64505588-64505610 GGGTGTGCCCAGGGAGGGGGAGG - Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
909698161 1:78490917-78490939 CTCTGTGCCCATGGAAAAGGGGG + Intronic
909863614 1:80637995-80638017 CAGTTTGCACTGGGAGAGGGAGG - Intergenic
910059194 1:83068374-83068396 ACCTGTGCCCAGGGAGATGGAGG - Intergenic
910589135 1:88910583-88910605 GAGTGTGCTGAGGGAAAAGGAGG + Intergenic
910763618 1:90759100-90759122 CAGAATGCCCAGGAAGGAGGAGG - Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
911041422 1:93593893-93593915 GTGTCTGCCCAGTGAGAAGGAGG - Intronic
911794026 1:102054187-102054209 CATTATGCCCAGGAAGAAGATGG + Intergenic
912107139 1:106293553-106293575 CAGTGTGCCTGGGGATAATGGGG + Intergenic
912111166 1:106345090-106345112 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
912248288 1:107984102-107984124 CTCTGTGCCCATGGAGAGGGTGG - Intergenic
912556225 1:110518074-110518096 CAGTGTCTCCAGGCAGAAGATGG + Exonic
912585782 1:110763479-110763501 CACAGTGGCCAGGGAGAAAGAGG + Intergenic
912949537 1:114111322-114111344 CAGTGTCCCCAGGTAAAAAGTGG - Intronic
913197482 1:116470009-116470031 CAGGGTGCCAAGGGATAAAGTGG - Intergenic
913220244 1:116654332-116654354 CAGAGGGCTCACGGAGAAGGGGG + Intronic
914850486 1:151310268-151310290 CAGAGGGCAAAGGGAGAAGGAGG + Intronic
915086507 1:153392717-153392739 CACCGTGCCCTGGGAGATGGAGG + Intergenic
915448832 1:155990565-155990587 CAGTCTTCCCTGAGAGAAGGAGG + Intronic
915535455 1:156532872-156532894 AAGGGAGCCCAGGAAGAAGGTGG + Intronic
915656484 1:157365151-157365173 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
915672803 1:157504420-157504442 CAGTTTGCACAGGAAGAGGGAGG - Intergenic
915824044 1:159056678-159056700 CAGTTTGCACAAGGAGAGGGAGG + Intergenic
916166544 1:161971229-161971251 CAGTGTGCCCTGGGAGTGGGCGG + Intergenic
917076821 1:171214467-171214489 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
917262853 1:173188794-173188816 CACTGAGCCCAGGGAGGCGGAGG - Intronic
917968360 1:180192504-180192526 CAGTGTGCCCCTGGAGGAAGTGG + Intronic
918174993 1:182035788-182035810 CAGTTTGCACTGGGAGAAGGAGG + Intergenic
918878632 1:190084489-190084511 CAGTTTGCACTGGGAGAGGGAGG - Intergenic
919850247 1:201667586-201667608 CAGTGGACCCGGGGAGGAGGAGG + Intronic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
922188437 1:223296370-223296392 GAGTGGGCCTAGGGAGAAGGGGG + Intronic
922334054 1:224604826-224604848 TACTGTGCCCAGGAAGAATGAGG + Intronic
922567780 1:226612123-226612145 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
922902625 1:229148414-229148436 CTTTGTGCCCAGGGAGCAGCTGG - Intergenic
923750982 1:236745873-236745895 CACTGTGCCCAGCCAGAACGTGG - Intronic
923913918 1:238481781-238481803 CAGTTTGCAAAGGGAGAAGGAGG + Intergenic
924045960 1:240030826-240030848 GATTGAGCCCAGGGGGAAGGAGG + Intronic
1062888626 10:1038751-1038773 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888643 10:1038814-1038836 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888660 10:1038877-1038899 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062888745 10:1039192-1039214 ACGTGTCCCCAGGGAGCAGGTGG + Intergenic
1062898733 10:1125690-1125712 CATTGTGGCCAGGCAGAAGCTGG + Intronic
1063020086 10:2118427-2118449 CAGTGTGCACAGGCAGAGGCAGG - Intergenic
1063949449 10:11208528-11208550 CAGAGAGGCCAGGGAGAATGCGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065091139 10:22234708-22234730 CCTTGAGCCCAGGGAGACGGAGG + Intergenic
1065127940 10:22592422-22592444 CTGTGTGCCCCAGGAGGAGGAGG + Intronic
1065502021 10:26392019-26392041 CAGTCTGCCCGGTGAGCAGGTGG - Intergenic
1065944399 10:30593699-30593721 CAGAGTGACCAAGGAGCAGGAGG - Intergenic
1067515584 10:46938783-46938805 CTGTGATCCCAGAGAGAAGGGGG - Intronic
1067556382 10:47276235-47276257 CAGTCTCCCCAGGGAGCAGGAGG + Intergenic
1067566181 10:47339604-47339626 AAGTGTGGCCAGGCAGCAGGAGG - Intergenic
1067646667 10:48113032-48113054 CTGTGATCCCAGAGAGAAGGGGG + Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069532730 10:69230985-69231007 CAGTGGACCCTGGGAGAGGGAGG - Intronic
1070602070 10:77872970-77872992 CAGAGTGCCCAGGGCTAAGGGGG + Intronic
1070642657 10:78180665-78180687 TGGGGTCCCCAGGGAGAAGGGGG - Intergenic
1071012298 10:80953051-80953073 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1071230605 10:83580801-83580823 CAGAGTGCTCAGGCAGAAGTGGG + Intergenic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1072913436 10:99522859-99522881 CACTCTGCCGAGGGAGAAGTAGG - Intergenic
1073148287 10:101294639-101294661 CAGAGAGACCAGGTAGAAGGTGG + Intergenic
1073205101 10:101764898-101764920 AAGTGTGTCCAGGGAGCAGCAGG + Intergenic
1073733200 10:106315637-106315659 CAATCTTCCCAGGGAGAGGGAGG + Intergenic
1074115660 10:110456029-110456051 CAGAATGCCCAGGGTGAATGTGG + Intergenic
1074855055 10:117467267-117467289 CAGCGAGGCCAGGGAGAAAGTGG - Intergenic
1075064462 10:119280101-119280123 CTCTGTGCCCAGGGAGTTGGAGG + Intronic
1075676832 10:124301734-124301756 AAGTGAGCCCAGGAAGCAGGAGG + Intergenic
1076122850 10:127950103-127950125 CAGTGTGCCCCATGAGGAGGTGG + Intronic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1076636028 10:131882434-131882456 GAGTGTGCCCTGGAAGGAGGCGG - Intergenic
1076697242 10:132252873-132252895 CAGAGTGACCTGGGAGGAGGCGG - Intronic
1076715998 10:132364068-132364090 TACTGTGCCCAGGGTGATGGGGG - Intronic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077214779 11:1390711-1390733 CATTGTGCCGCGGGAGGAGGGGG + Intronic
1077217181 11:1399799-1399821 CAGGGTGCCAAGGAAGAAGGAGG - Intronic
1077281818 11:1749385-1749407 CAGTGGGTCCGGGGAGATGGAGG - Intronic
1077490501 11:2858796-2858818 CAGTGAGCAGATGGAGAAGGTGG + Intergenic
1077633647 11:3827351-3827373 CAGTGTTCCCAAGCAGAGGGGGG + Exonic
1078739189 11:14050778-14050800 CAGTGTGCCCAGGGTAAACCGGG + Intronic
1079476978 11:20841403-20841425 CCCAGTGCCCAGGGAGAAGGCGG + Intronic
1079686031 11:23360937-23360959 CCGTGTGGCCAGTGAGAAGTAGG - Intergenic
1080075039 11:28139025-28139047 CGGTCTGCACAGGGAGAGGGAGG + Intronic
1080186316 11:29491357-29491379 GGGTGTGCCCAGGTTGAAGGTGG - Intergenic
1081191230 11:40104939-40104961 CAGTTTACACAGGGAGATGGAGG - Intergenic
1081758575 11:45561359-45561381 AATTGGGCCCAGGGAGATGGCGG + Intergenic
1082747795 11:56984954-56984976 CAGTTTACACAGGGAGAGGGAGG + Intergenic
1083125756 11:60564217-60564239 TAGTTTGCACAGGGAGAGGGAGG + Intergenic
1083160076 11:60849239-60849261 CAGTGTGCCCAAGGAGCTAGGGG + Intronic
1083171304 11:60925194-60925216 CAGGGAGCCCTGGGGGAAGGGGG - Intronic
1083376444 11:62226639-62226661 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
1083715431 11:64572509-64572531 CAGTGTACACAGGGTGAAAGAGG - Exonic
1084154533 11:67306309-67306331 CACTGTGCCCAGCAAGAAGGAGG - Intronic
1084312247 11:68323930-68323952 GAGTGTCCCAAGGGAGCAGGCGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085295626 11:75430120-75430142 CAGCGGGGCCAGCGAGAAGGCGG + Exonic
1085638670 11:78177521-78177543 CAGAGGGCCCAGGCAGGAGGTGG + Intronic
1085841077 11:80012584-80012606 CAGATTGCTGAGGGAGAAGGTGG + Intergenic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1087464952 11:98492563-98492585 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1087781569 11:102306364-102306386 CAGTGTGCCCTGGGGAAAGGGGG + Intergenic
1088241707 11:107779958-107779980 CAGTGTACCCAGACAGAACGAGG + Intergenic
1088784259 11:113166169-113166191 CACATTTCCCAGGGAGAAGGCGG - Intronic
1088792097 11:113235201-113235223 CACTGCCCCCAGGGAGAAGAAGG - Intronic
1088902680 11:114130060-114130082 CAGGATGCCCAGGGAGGAGCAGG + Intronic
1089289608 11:117429736-117429758 CAGGGTGCCCATGGAGCACGGGG - Intronic
1089465092 11:118679784-118679806 CACTGTGCCCTGAGAGCAGGAGG - Intergenic
1089769901 11:120795323-120795345 CAGTTTACCCAGGGAGCAGGAGG + Intronic
1090266825 11:125358701-125358723 CAGTTAGCCCAGGGAGAGGAAGG - Intronic
1090272046 11:125393641-125393663 CCGTGTGCACATGGAGAAGCAGG + Intronic
1090451575 11:126810955-126810977 GAGTGTGTGCAGGGAGGAGGTGG + Intronic
1090740424 11:129654606-129654628 CAGTGTGGAGAGGGAGCAGGTGG - Intergenic
1091410887 12:238687-238709 CATTGTGCCCATGAAGACGGTGG + Intronic
1091569294 12:1670447-1670469 CTGAGTGCCCAGGGAGAAGGAGG - Intergenic
1092306896 12:7310618-7310640 CATTGTGGCCAGTGAGGAGGTGG + Exonic
1092585692 12:9899081-9899103 CAGTTTGCACAGGGAGAGGCAGG + Intronic
1092928312 12:13291965-13291987 CAGAGTACCCAGGGTGAAGAAGG - Intergenic
1093798020 12:23337088-23337110 CAGTGTGCTTAGGGAGCTGGTGG - Intergenic
1095738271 12:45581723-45581745 GAGTGAGCAAAGGGAGAAGGAGG - Intergenic
1096113923 12:49044158-49044180 CAGTGGGGCCTGGGAGAAGGTGG - Intronic
1096143229 12:49259847-49259869 CTGTGTGTCCTGGGAGCAGGAGG + Intronic
1096148844 12:49296310-49296332 CGGTGGGCGCGGGGAGAAGGGGG + Intronic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1096651192 12:53062720-53062742 CTTGGTGCCCAGGGAGAGGGAGG - Intronic
1097499796 12:60388193-60388215 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
1098805507 12:75016468-75016490 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1099631776 12:85157749-85157771 CAGAGTGCTCAGAGAGAATGGGG + Intronic
1099738221 12:86597841-86597863 CAGGGTGCCAAGGGAGGAGGTGG - Intronic
1100268784 12:93003737-93003759 CAGTGAGCACAGGGAGGAGGAGG + Intergenic
1101220618 12:102635412-102635434 ACGTGAGGCCAGGGAGAAGGTGG + Intergenic
1101236084 12:102791852-102791874 CAGTGTGGTCAGGCTGAAGGTGG + Intergenic
1102410139 12:112710328-112710350 CAGTTTGCCCAGGAAGAACGGGG - Intronic
1103143342 12:118571510-118571532 CAGTGCCCCAAGGGAGAATGTGG + Intergenic
1103769439 12:123309662-123309684 CAATGTCCCCAGGGAAAATGTGG - Intronic
1104014453 12:124952760-124952782 CTTTGTCCCAAGGGAGAAGGAGG - Intronic
1105818113 13:24055411-24055433 CTGTCTGCCTAGGGAGATGGAGG + Intronic
1106043685 13:26117755-26117777 GGGTGTGTCCAGGGAGCAGGTGG - Intergenic
1106172049 13:27296702-27296724 CAGATTGCTCAGGGAGCAGGAGG - Intergenic
1106231290 13:27823227-27823249 AAGTGTGTGCAGGGCGAAGGCGG - Intergenic
1107111623 13:36704227-36704249 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1107404231 13:40097978-40098000 CAGTGTGGACAGGGAGGAAGAGG + Intergenic
1107696027 13:43001112-43001134 CAATGTAGCCAGTGAGAAGGGGG + Intergenic
1107829632 13:44362877-44362899 CAGAGTGCCCAGAGAACAGGAGG + Intergenic
1108204235 13:48072026-48072048 CAGTTTGCACACGGAGAAAGAGG - Intronic
1108418509 13:50225366-50225388 AAGGGTGGCCTGGGAGAAGGGGG + Intronic
1109013016 13:56974655-56974677 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1109561247 13:64052900-64052922 CAGTTTGTACAGGGAGAAGGAGG + Intergenic
1110257157 13:73444972-73444994 CAGTTTGCCCAGGGAGAGGGAGG - Intergenic
1111133013 13:84000269-84000291 CAGTTTGCACAGGGAGATGGAGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112237776 13:97651725-97651747 TAGTGTGCCCAGGGATAAGATGG + Intergenic
1112549243 13:100404231-100404253 CAGTTTGCACAGGGAGAAGGAGG + Intronic
1113488795 13:110676310-110676332 CAAGGGGACCAGGGAGAAGGCGG + Intronic
1113562306 13:111291453-111291475 CAGCGCGCCCTGGGAGCAGGGGG + Intronic
1113930306 13:113964787-113964809 GGCAGTGCCCAGGGAGAAGGGGG + Intergenic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1114388389 14:22279474-22279496 CAGTGAGCCCAGGCAAGAGGCGG + Intergenic
1115543477 14:34444049-34444071 CATTTTGCACAGGGAGAAAGCGG - Intronic
1116726210 14:48563992-48564014 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1117438689 14:55741132-55741154 CAGTGTGCCCTGGGAGATGGGGG + Intergenic
1118478554 14:66141517-66141539 CAGTGTGGGAAGGGAGCAGGTGG - Intergenic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1119217395 14:72879606-72879628 AAGTGCGCCCAGGGACAGGGTGG + Intronic
1119415171 14:74465049-74465071 GAGAGTGCCCAGGGAGGAGCAGG - Intergenic
1119757807 14:77131074-77131096 CAGGGTCCCCAGGGAGGAGCAGG + Intronic
1119857012 14:77908406-77908428 CAGTATTCCCTGGGACAAGGGGG - Intronic
1119894380 14:78207311-78207333 TAGAGTGCGCAGGAAGAAGGTGG - Intergenic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120200492 14:81533562-81533584 AGATGTGCCCAGGGAGAACGGGG + Intronic
1120250652 14:82058866-82058888 CAGTGTGCTCATGAACAAGGTGG - Intergenic
1120314352 14:82872456-82872478 CAATTTGCACAGGGAGAGGGAGG - Intergenic
1121740837 14:96251346-96251368 CAGGATGGCCAGCGAGAAGGTGG + Intronic
1122324626 14:100874960-100874982 CTTTGTGCCCAGGGTGGAGGGGG + Intergenic
1122372165 14:101234765-101234787 CAGTGAGCCCAGGGACCCGGGGG + Intergenic
1122381862 14:101313565-101313587 GAGAGAGCCCAGGGAGAAGCAGG - Intergenic
1202882291 14_KI270722v1_random:72086-72108 CACTGTGCCCAGCCAAAAGGAGG - Intergenic
1123479263 15:20616039-20616061 CATTGTCCCCAGGGAGCAGGGGG + Intergenic
1123492440 15:20792822-20792844 CACTGTGCCCAGGGAGGTTGAGG - Intergenic
1123548942 15:21361914-21361936 CACTGTGCCCAGGGAGGTTGAGG - Intergenic
1123638750 15:22384346-22384368 CATTGTCCCCAGGGAGCAGGGGG - Intergenic
1124140390 15:27072317-27072339 AAGGGTGTCCATGGAGAAGGAGG - Intronic
1124576275 15:30911773-30911795 CACTGTGCCCAGCCAGAGGGTGG - Intronic
1124721586 15:32115438-32115460 CAGTGTGTCCAGGCAGGAAGGGG - Intronic
1125483161 15:40094212-40094234 CAAGTTGCCCAGGGAGTAGGTGG - Intronic
1125523631 15:40361952-40361974 CAGAGTGCCCAGGGCCATGGGGG - Intronic
1125550458 15:40540870-40540892 CAGAGAGCCCAGTGAGAAGCTGG + Intronic
1126826243 15:52552279-52552301 CACTGTGCCCAGTCTGAAGGGGG - Intronic
1126907900 15:53387079-53387101 CAGTGTGTTAAGGGAGAAGCAGG + Intergenic
1127052756 15:55101732-55101754 CAATGTGACAAGGTAGAAGGAGG - Intergenic
1127172806 15:56321238-56321260 GAGTATGCCCTGGGACAAGGGGG - Intronic
1127365340 15:58284279-58284301 CCTTGGGCACAGGGAGAAGGAGG + Intronic
1127857821 15:62967219-62967241 CCCTGTCCCCAGGGAGGAGGTGG + Intergenic
1127914552 15:63444700-63444722 CTGTGTGTGCAGGGAGAGGGTGG + Intergenic
1128138604 15:65282814-65282836 AAGTGGGGCAAGGGAGAAGGGGG + Intronic
1128173155 15:65530622-65530644 CAGTGTGGCCATGGAGAATCAGG + Exonic
1129333918 15:74841337-74841359 GAGTGAGCCCAGGCAGAGGGAGG + Intronic
1129691838 15:77718156-77718178 CCGTGGGCCCTGGAAGAAGGTGG - Intronic
1129928092 15:79384061-79384083 CAGTGTTCCTATGGAGATGGTGG + Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1130984982 15:88838820-88838842 CCGTGTGTCCAAGGAGAAGGAGG + Exonic
1132294477 15:100725435-100725457 CAGTGTGCACAGGGAGACCCCGG + Intergenic
1132522961 16:399881-399903 CTGTGTGCCCTGGGAGAACACGG - Intronic
1132840194 16:1975104-1975126 CAGTGGGCCCTGGTAGGAGGGGG + Intronic
1132969658 16:2680226-2680248 CACTGTGGGCAGGGAGATGGGGG - Intergenic
1132984490 16:2757362-2757384 CTGTGTGCGCATGGAGAGGGAGG + Intronic
1133040060 16:3056030-3056052 CTGTGTTCCCAAGGAGATGGAGG + Intronic
1133043936 16:3075875-3075897 CTGTGTTCCCAAGGAGATGGAGG + Intronic
1135231403 16:20711552-20711574 CATTGTGGCCAGTGAGGAGGTGG + Intronic
1136064011 16:27746746-27746768 CAGCCTGTCCAGGGAGCAGGAGG + Intronic
1137886642 16:52111540-52111562 CACTGTGCCCAGCCAGAAGTAGG - Intergenic
1137926636 16:52547101-52547123 CAGTCCGCCCGGGGAGGAGGAGG - Intronic
1138515550 16:57533913-57533935 CAGTATGCCAAGGGAACAGGAGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1140409603 16:74733974-74733996 CGTGGTGCCCAGGTAGAAGGGGG - Intronic
1140409779 16:74734642-74734664 CATGGTGCCCCGGTAGAAGGGGG + Intronic
1141336800 16:83163545-83163567 CTGTGTGCCCAGGAGGAACGGGG - Intronic
1141469035 16:84226072-84226094 CGGTGTGCCCAGGGCCCAGGGGG - Intronic
1142178262 16:88654977-88654999 CTGTGAACCCAGGAAGAAGGTGG + Intronic
1142245822 16:88969620-88969642 CAGGGAGCCGAGGGAGAGGGGGG + Intronic
1142337876 16:89502020-89502042 CAGTGTGGACATGGAGCAGGAGG - Intronic
1142496061 17:306915-306937 CAGTGTGCCCAGGAAGTGTGGGG - Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143174249 17:4947545-4947567 CAGTGTGGACAGGGAGATGGTGG + Intronic
1143204107 17:5131141-5131163 CACTGTCCCCATGGGGAAGGGGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143214822 17:5216951-5216973 CAGTGTACCTAGGGGGATGGAGG - Intronic
1143321731 17:6072725-6072747 CAGGAGGCCCAGGGAGAAGGTGG - Intronic
1143393923 17:6576858-6576880 CCGTGAGCCCAGGGAGGAAGTGG + Intergenic
1143434707 17:6914848-6914870 CATTGCACCCAGGAAGAAGGAGG + Intronic
1143499489 17:7330442-7330464 CAGTGGGGCCATGGAGAAGGTGG + Intergenic
1144132411 17:12259729-12259751 CAGTGTGCTAAGGAAGATGGTGG + Intergenic
1144328437 17:14203944-14203966 CAGGGACCCCATGGAGAAGGTGG + Intronic
1144391877 17:14801062-14801084 CAGTGTTCCAAGAGAGAATGTGG - Intergenic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1144781763 17:17811859-17811881 CCATGTGCCCTGGGAGCAGGGGG + Intronic
1144875288 17:18394250-18394272 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145156936 17:20550171-20550193 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1145781431 17:27566386-27566408 CAGTGTCCCAGGGAAGAAGGAGG - Intronic
1145799100 17:27672043-27672065 CACTGTCCCCATGGGGAAGGGGG - Intergenic
1146063667 17:29619728-29619750 CAGTGTGCCCAGTGACCAGTGGG + Exonic
1146159914 17:30554232-30554254 CACTGTCCCCATGGGGAAGGGGG + Intergenic
1146536463 17:33657038-33657060 CAGAGTGGCTAGGGAGAAGGAGG + Intronic
1147745191 17:42690596-42690618 CAGAGTGCCCAGGGCAGAGGTGG + Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1148910089 17:50937648-50937670 CAGTGTGGAACGGGAGAAGGGGG - Intergenic
1150921239 17:69485752-69485774 CAGTGTCCCAAGGGACAACGTGG - Intronic
1151871202 17:76838132-76838154 CCGTGTGCTCAGGGCGAAGGTGG - Intergenic
1152058173 17:78049162-78049184 CAGAGTGCCCTTGGAGCAGGGGG + Exonic
1152233286 17:79125546-79125568 CAGGGAGCTCAGGGAGCAGGCGG + Intronic
1152720993 17:81923807-81923829 CTGTGCACCCAGGGAGCAGGGGG - Intronic
1153550757 18:6259062-6259084 CAGAGTGCCCGGGGGGAAGCAGG + Intronic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154334734 18:13456360-13456382 CAAGGTGCACAGGGAGCAGGAGG - Intronic
1154365264 18:13702206-13702228 CAGTTTGCACAGGGAGAGAGAGG - Intronic
1154383571 18:13873309-13873331 CAGTGTGCCCAGGAAGGAAAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156098140 18:33561376-33561398 CAGTTTGCACAGGGAAATGGAGG + Intergenic
1156276977 18:35593066-35593088 CAGGGTTCCACGGGAGAAGGAGG + Intronic
1156287023 18:35706710-35706732 CCCTCTGCCCAGGGAGAGGGAGG - Intronic
1156698454 18:39795769-39795791 CAGTTTGCAGAGGGAGAGGGAGG + Intergenic
1157442394 18:47720900-47720922 AGGTGAGCCCAGGGAGAAGGAGG + Intergenic
1157793697 18:50556741-50556763 CACTGGGCCCAGGCAGAAAGAGG + Intergenic
1158641399 18:59207013-59207035 CAGTTTGCCCAGGAAGATAGGGG - Intergenic
1159582980 18:70253666-70253688 CAGGGTGCTGAGGGTGAAGGGGG - Intergenic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1160078135 18:75697436-75697458 CAATGTGGCCAGGTAGAAGGAGG + Intergenic
1160509857 18:79447290-79447312 CAGCGAGGCGAGGGAGAAGGCGG - Intronic
1160603648 18:80033500-80033522 CTAGGTGCCCGGGGAGAAGGCGG + Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1161389151 19:4012133-4012155 CAGTGTCCACAGGGCCAAGGAGG + Intronic
1161875022 19:6901723-6901745 CTGTGTGCCTGGGAAGAAGGGGG + Intronic
1162966284 19:14157685-14157707 CAGAGTGCCTTGGGAGACGGTGG + Intronic
1163369159 19:16892467-16892489 CAATGTCACCAGGGATAAGGTGG + Exonic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1164414456 19:28034755-28034777 CGGTGCACCCAGGGAGAATGTGG + Intergenic
1164492889 19:28730451-28730473 TAGTGTTCCCAAGGATAAGGGGG + Intergenic
1164519025 19:28963339-28963361 CGGTGCGCTCAGGGAGAAAGTGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164974385 19:32560892-32560914 AAGTCTGGCCAGGGAGAAGGGGG + Intergenic
1165040164 19:33063380-33063402 CTGTGTCACCTGGGAGAAGGAGG + Intronic
1165406287 19:35633150-35633172 CAGGGGGCCCAGGCAGAGGGGGG - Exonic
1165472804 19:36013309-36013331 CAGGGTGCAGAGGGTGAAGGAGG - Intronic
1166128903 19:40733627-40733649 CAGGATGCCCAGGGAGACAGAGG - Intronic
1166798817 19:45443790-45443812 TAGGATCCCCAGGGAGAAGGAGG - Intronic
1167235126 19:48309594-48309616 TACTGTGTCCAGGAAGAAGGAGG - Intronic
1168144994 19:54415728-54415750 CTGGGTCCCGAGGGAGAAGGGGG + Intronic
1202657902 1_KI270708v1_random:41184-41206 CACTGTGCCCAGCCAAAAGGAGG - Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
925161489 2:1687238-1687260 CAGGGTGCCCGGGGAGGAGAGGG - Intronic
925379249 2:3413734-3413756 CAGTGTGCACAGGGATGAGGTGG + Intronic
925591271 2:5512394-5512416 CACAGTGGCCTGGGAGAAGGAGG - Intergenic
926227591 2:10979259-10979281 CAGTTGACCCAGGGACAAGGGGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926503623 2:13684045-13684067 CAGTCTGCACAGAGAGAAAGAGG - Intergenic
926926994 2:17996825-17996847 CAGTTTGCACAGGGAGAGGGAGG - Intronic
927168747 2:20350868-20350890 CAGTGCACCCCGGGAGAAAGGGG + Intronic
927876216 2:26656952-26656974 GAGGGTGACCAGGGAGGAGGGGG + Intergenic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
929031076 2:37650315-37650337 CAGTGAGCCCAGGAAGCAGAAGG - Intronic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929353453 2:40990280-40990302 CCTAGTCCCCAGGGAGAAGGAGG - Intergenic
929784623 2:44980181-44980203 CAGACTGCCCGGGGAGGAGGGGG - Intergenic
931892264 2:66686425-66686447 CAGTGAGACCTGGAAGAAGGGGG - Intergenic
932310247 2:70734058-70734080 CAGTGTCCCCGGGGAGAGGGGGG - Intronic
933763084 2:85687480-85687502 CTGGGTGGCCAGGGAGATGGTGG - Intronic
934735227 2:96686566-96686588 CACCGTGCCCAGCGAGGAGGTGG - Intergenic
936250729 2:110866458-110866480 CCGAATGCCCAGGGAGGAGGTGG + Intronic
936719575 2:115234608-115234630 CAGTGTGCATGGTGAGAAGGTGG - Intronic
936840095 2:116758349-116758371 CAGTTGGCCCAGGGAAAGGGAGG - Intergenic
937886073 2:126900795-126900817 TAGTGTGCCTGGGGAGTAGGGGG - Intronic
938117690 2:128613009-128613031 CTGGGTCCCCAGGCAGAAGGGGG + Intergenic
940073472 2:149715477-149715499 CAATGTGACCATGGAGGAGGAGG - Intergenic
940569166 2:155408102-155408124 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
941249866 2:163148315-163148337 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
942333663 2:174856622-174856644 CACTATGCCCAAGGAGGAGGGGG + Intronic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942934831 2:181542148-181542170 AAGTGTGGACAGTGAGAAGGGGG + Intronic
943501332 2:188693245-188693267 CAGTGTAGACAGGGAGCAGGTGG + Intergenic
943529749 2:189064636-189064658 CAGGGTGCTCAAGGAGAACGGGG - Exonic
944327332 2:198421900-198421922 TAGTGTTCTCAGGGAAAAGGTGG + Intronic
946136298 2:217650360-217650382 CTGTGTGCCCAGGAAGATGTGGG - Intronic
946297197 2:218794541-218794563 CAGTTTGCCCAGGGAGAGGGAGG + Intronic
946413267 2:219526281-219526303 GAGAGGGGCCAGGGAGAAGGAGG + Intronic
946654620 2:221933073-221933095 CCCTGTGCACAGTGAGAAGGTGG - Intergenic
946965377 2:225031531-225031553 AGGTGTGAGCAGGGAGAAGGAGG + Intronic
947390652 2:229636084-229636106 CGGTGTGCCACGGGAGAATGTGG - Intronic
947516259 2:230807484-230807506 GAGTCTGCCCAAGGAGCAGGTGG - Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
1168975295 20:1961386-1961408 CAGTGATCTCGGGGAGAAGGTGG - Intergenic
1169325282 20:4670727-4670749 CGGTGAGCACAGGGAGAATGGGG + Intergenic
1170159748 20:13299117-13299139 CAGCGGGCCCAAGGAGAAGCTGG + Exonic
1170222275 20:13953185-13953207 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1171056377 20:21910808-21910830 CAGCGTCCCTAGGGAGAAAGGGG + Intergenic
1172222450 20:33283243-33283265 CAGCGTGCCCAGGTAAAAGTAGG + Exonic
1172607167 20:36221845-36221867 CAGTCTGCAGAGGGAGAGGGAGG - Exonic
1172785284 20:37464585-37464607 AAGGGTGCCCAGGAAGGAGGGGG - Intergenic
1172891379 20:38268307-38268329 CAGGCTGCCCAGGAAGCAGGTGG - Intronic
1173669654 20:44789877-44789899 TAATGGGCCCAGGGAGAAGAAGG + Intronic
1175177324 20:57120108-57120130 CAGTGTGCCCTGGGAAAAGCTGG - Intergenic
1175755374 20:61526206-61526228 AAGTCTGCCCAGGCAGAAGCAGG + Intronic
1175916760 20:62429595-62429617 CTGGGTCCCCAGGGAGAAGGTGG + Intergenic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1176061266 20:63173942-63173964 CACTGGGGCCAGGGAGGAGGGGG + Intergenic
1176149379 20:63581510-63581532 CTGTATGTCCAGGGAGAAGAGGG - Intergenic
1176155717 20:63619358-63619380 GAGTGTGCACATGGAGGAGGTGG - Exonic
1176998693 21:15585451-15585473 CACTGTGCCCAGGCAAAAGCAGG - Intergenic
1177543086 21:22520787-22520809 CAGCTTGCACAGAGAGAAGGAGG - Intergenic
1178363649 21:31970308-31970330 CACCGTGCCCAGAGAGGAGGTGG + Intronic
1178619533 21:34161614-34161636 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1178642017 21:34352397-34352419 GGGTGTTCCCAGGGAGAAGCTGG + Intergenic
1179447271 21:41441044-41441066 CACTGTGCTCAGTGAGAATGGGG + Intronic
1179721474 21:43318689-43318711 CAGTGTGTCCAGTGAAAAGCTGG + Intergenic
1179837582 21:44047111-44047133 CAGTGCGCCGAAGGAGTAGGTGG - Intronic
1180156621 21:45981491-45981513 CTCCGAGCCCAGGGAGAAGGCGG - Intergenic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1180821544 22:18832351-18832373 CAGAGGGCTCACGGAGAAGGGGG + Intergenic
1181064235 22:20298288-20298310 CAAGGTGCACAGGGAGAAGCAGG + Intergenic
1181191434 22:21143694-21143716 CAGAGGGCTCACGGAGAAGGGGG - Intergenic
1181207764 22:21266816-21266838 CAGAGGGCTCACGGAGAAGGGGG + Intergenic
1181318287 22:21985283-21985305 CACTCTGACCAGGGAGATGGTGG + Intergenic
1181809291 22:25393590-25393612 GAGTGTCCCAAGGGAGCAGGCGG + Intronic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1181931190 22:26402914-26402936 CAGAGTTCCCAGGGAGATCGGGG + Intergenic
1183019531 22:35016128-35016150 CAGTCTGCCCAGGCTCAAGGTGG + Intergenic
1183390051 22:37540614-37540636 CAGTGGGCTGAGGGAGATGGAGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183511424 22:38237423-38237445 CAGTGTGCCCAGGGTCATCGGGG - Intronic
1183522595 22:38303998-38304020 CAGTGGGCCCAGGCAGAGAGCGG - Intronic
1183539162 22:38419601-38419623 CAGTGCCCACAGTGAGAAGGAGG - Intergenic
1184108853 22:42383748-42383770 AAATGTGCCCAGGGAGGGGGGGG - Exonic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184251609 22:43263558-43263580 CGGTGTGTCCCGGGGGAAGGAGG - Intronic
1184274730 22:43403922-43403944 CAGTGGGCAAAGGGAGCAGGTGG + Intergenic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184795798 22:46731715-46731737 ACGTGTGCCCCGGGAGCAGGTGG + Intronic
1184806054 22:46795524-46795546 CAGCTTGCGCTGGGAGAAGGGGG + Intronic
1184889322 22:47369845-47369867 AAGGGTGGACAGGGAGAAGGAGG - Intergenic
1184972636 22:48037381-48037403 CTGTGTGCCCATGGAGAGGCTGG - Intergenic
1184984435 22:48119896-48119918 CACTGTGCCCTGGGAGAGGCTGG + Intergenic
1185173616 22:49307112-49307134 CAGTGAGGCCAGGGCCAAGGGGG + Intergenic
1185262255 22:49874131-49874153 GAGTCTGCCCAGGCAGGAGGCGG - Intronic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
1203219156 22_KI270731v1_random:28600-28622 CAGAGGGCTCACGGAGAAGGGGG - Intergenic
1203271669 22_KI270734v1_random:58227-58249 CAGAGGGCTCACGGAGAAGGGGG + Intergenic
949658300 3:6247366-6247388 CAGTGAGCCCTGGGAGGTGGAGG + Intergenic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
950201952 3:11050758-11050780 CAGGGAGCTCAGGGAGCAGGGGG - Intergenic
950485204 3:13269265-13269287 CTTAGTGCTCAGGGAGAAGGTGG + Intergenic
951345973 3:21547308-21547330 CAGTTTGCACAGGGAGAGGGAGG - Intronic
951564833 3:24002917-24002939 AAGTGTCCCAAGGGAGATGGTGG - Intergenic
951841700 3:27041238-27041260 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
952173047 3:30830519-30830541 CAGAATGGCCAGGGAGATGGTGG - Intronic
953058480 3:39406944-39406966 CAGAGTGCCCCGGGAGCGGGTGG + Intronic
953663100 3:44905379-44905401 AAGTGTGCCCAGGGACCAGCCGG + Intronic
953687742 3:45091410-45091432 CAGCGTGCCCAGAGACCAGGTGG - Exonic
953891749 3:46756260-46756282 CAGGCTGCCCAGGGCGGAGGCGG + Exonic
953990279 3:47478052-47478074 CAGTGGGCCCAGGGCTCAGGAGG - Intergenic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
956024752 3:64971019-64971041 CAGCATGCAAAGGGAGAAGGAGG - Intergenic
956412696 3:68995111-68995133 CAGTTTGCCCAGGGAAGAGCAGG - Intronic
956657539 3:71566917-71566939 CTGAGAGCCCAGGGAGAAGATGG - Intronic
958536641 3:95412279-95412301 CAGTTTTCACAGTGAGAAGGAGG - Intergenic
958744328 3:98114227-98114249 CAGTTTACACAGGGAGAGGGAGG - Intergenic
959637706 3:108593785-108593807 CTGTGTTCCCAGGGAGGATGAGG - Intronic
961081992 3:124034612-124034634 CTGTGTAGCCAGGGAGCAGGAGG - Intergenic
961445385 3:126978209-126978231 CTGTGTGCCAAGGGACAGGGAGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961606424 3:128098849-128098871 CAGTGTGCCCTGTGAGCAAGGGG - Intronic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
962796828 3:138856592-138856614 TACTGTGGCCAGGGAGATGGAGG - Intergenic
963434026 3:145244957-145244979 CAGTGTGTACAGGAAGATGGAGG + Intergenic
963834933 3:150048491-150048513 CTGTGTGCCCAGGCAGTGGGTGG - Intronic
963906707 3:150779156-150779178 CGGTGTGCCCAGGGAAAAGGTGG - Intergenic
964304378 3:155325202-155325224 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
965614000 3:170574520-170574542 CAGTGTGCTCAGGAAGAAAAAGG - Intronic
966523742 3:180899523-180899545 CAGTTTGCACAGGGAGAGGGAGG - Intronic
966822146 3:183933463-183933485 CAGGGAGCTCTGGGAGAAGGTGG + Intronic
966833990 3:184035404-184035426 AAATGGGCACAGGGAGAAGGTGG + Intronic
968381509 4:100689-100711 CAGTTTGCACAGGGAGACGGAGG - Intergenic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
969458135 4:7312713-7312735 CAGAGTGCCCGGGGACAAGACGG + Intronic
969538739 4:7772741-7772763 CAGTGCACCCAGAGAGAATGTGG - Intronic
969686025 4:8674737-8674759 CAGTGAGCCCAGCCTGAAGGAGG + Intergenic
969827152 4:9766716-9766738 CAGTTTGCCCAGGATGAAGCCGG + Intergenic
972337057 4:38116426-38116448 CAGTGTGCCCAAGGTGGAAGTGG - Intronic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
973700696 4:53534139-53534161 CAGTTACCCCATGGAGAAGGGGG + Intronic
973846071 4:54914460-54914482 CTGGGTGCTCAGGGAGGAGGTGG - Intergenic
974649005 4:64730123-64730145 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
975176999 4:71300302-71300324 CAGCATGGCCAGGAAGAAGGTGG + Intronic
975361615 4:73477304-73477326 CAGTGTGGAGAGGGAGCAGGTGG + Intergenic
975424377 4:74209137-74209159 CAGTTTGCACAGGGAGAGTGAGG + Intronic
975756643 4:77578128-77578150 CAGTTTGCACAGGGAGAGGGAGG - Intronic
976167643 4:82272290-82272312 CTCTGTCCCCAGGGAGATGGGGG - Intergenic
976582160 4:86749817-86749839 AAGTCAGCCCAGTGAGAAGGTGG + Intronic
979011617 4:115377693-115377715 CTGTGGGCCGAGGGAAAAGGTGG - Intergenic
979104630 4:116668151-116668173 CGGTTTGCACAGGGAGAGGGAGG - Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979507425 4:121514302-121514324 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
980003936 4:127519557-127519579 CGATTTGCCTAGGGAGAAGGTGG + Intergenic
980639644 4:135560572-135560594 GTGTGTACCCAGAGAGAAGGAGG - Intergenic
981324176 4:143427497-143427519 CGGTTTGCACAGGGAGAGGGAGG + Intronic
981456808 4:144962255-144962277 CAGTTTGCACAGGGAAAAGGAGG - Intergenic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
982399623 4:154952738-154952760 CAGTTTGCACAGGGAGAGAGAGG + Intergenic
982404849 4:155008172-155008194 CAGTGTGCCTAGAGAAAAGGAGG - Intergenic
982477620 4:155872637-155872659 CAGTTTGCACAGGGAGAGGGAGG + Intronic
982576029 4:157111202-157111224 AAGTGTTCTCAGGGAGAAGCTGG + Intronic
982759744 4:159267073-159267095 CAGTGTGTATAGGGAGAGGGAGG + Intronic
984429052 4:179625126-179625148 CAGTAGGCCCTGGGAGAAGGAGG - Intergenic
984947748 4:184983169-184983191 CAATAAGCCCAGGGAGTAGGTGG - Intergenic
985519901 5:369280-369302 CAGAATGCCCAGGAAGAGGGAGG - Intronic
985539939 5:483166-483188 TACTGGGCCCAGGGAGATGGAGG - Intronic
985585316 5:729371-729393 CTGTGTGCCCAGAGAGCACGGGG + Intronic
985598828 5:813698-813720 CTGTGTGCCCAGAGAGCACGGGG + Intronic
985765669 5:1778195-1778217 CAGTGTTCCCAGGGAGGGAGAGG - Intergenic
986255910 5:6101427-6101449 CAGGATGCCCATGGAGAGGGAGG - Intergenic
986418358 5:7550835-7550857 CAGGGGCCCCAGGGAGCAGGTGG - Intronic
986447170 5:7831780-7831802 AAGTTTGCACAGCGAGAAGGTGG - Exonic
987463454 5:18243849-18243871 TAATGTGCACAGTGAGAAGGTGG - Intergenic
988157803 5:27477225-27477247 CAGTTTGCACAGGGAGAGAGAGG - Intergenic
988237265 5:28561650-28561672 CAGTGTGCCCAGGTACTGGGGGG - Intergenic
988899602 5:35718124-35718146 CAGTTTGCACAGGGAGAGGTAGG + Intronic
989167573 5:38446245-38446267 CAGAAAGGCCAGGGAGAAGGAGG - Intronic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
990650055 5:57888143-57888165 CAGTTGCCCCTGGGAGAAGGTGG + Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
992624899 5:78628085-78628107 CAGTGTGCCAAGGGAGGGGCCGG - Intronic
992723186 5:79580647-79580669 CAGTGTCCCCAGGCAGAAAGGGG - Intergenic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
994505821 5:100641834-100641856 CAGTTTGCACAGGGAGAGGCAGG - Intergenic
994979639 5:106857033-106857055 CACTGTGCACTGGGGGAAGGGGG - Intergenic
995393468 5:111663673-111663695 CAGTTTGCTCAGGGAGAGGAAGG + Intronic
997642771 5:135460373-135460395 CAGCGTGGCAAGGGGGAAGGAGG - Intergenic
997761581 5:136453882-136453904 AAGTCTACCCAGGGTGAAGGTGG - Intergenic
997775112 5:136597176-136597198 AAGTGTACCCAGAGAGTAGGGGG - Intergenic
998253500 5:140568080-140568102 CAATGTGGCCAGGAAGAAGGCGG - Exonic
999080445 5:148838480-148838502 CAGAGTACCCAGGGACAAGGTGG + Intergenic
999362129 5:150994225-150994247 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1000741265 5:164973219-164973241 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
1001186617 5:169580139-169580161 AAGTGCGCACAGCGAGAAGGAGG - Intergenic
1001260809 5:170227010-170227032 CATGGTGGCCAGGGAGAATGTGG - Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005582535 6:27248327-27248349 CAGTCTGGACAGGGACAAGGGGG - Intronic
1006223659 6:32518069-32518091 CAGAGTGCCCTGGGAAAAAGAGG + Exonic
1006361242 6:33588595-33588617 CACTGTGCTGAGGGGGAAGGAGG + Intergenic
1006453219 6:34117402-34117424 CAGGGGGGCCTGGGAGAAGGAGG - Intronic
1006948165 6:37799480-37799502 GAATTTGCCCAGGGAGAGGGAGG - Intergenic
1007370803 6:41426031-41426053 CAGTGAGCTCAGTGAGGAGGTGG + Intergenic
1007626999 6:43252335-43252357 CACTGTGCCCGGCCAGAAGGGGG - Intronic
1009632260 6:66214372-66214394 CAGTTTGCACAGGGAAAGGGAGG - Intergenic
1009907544 6:69888277-69888299 CAGTTTGCACAGGGAGACGGAGG + Intronic
1009907852 6:69891164-69891186 CAGTTTGCACAGGGAGAGGGAGG + Intronic
1012208412 6:96490157-96490179 CTGTGAGCCAAGGGAGAAAGAGG + Intergenic
1012583842 6:100899004-100899026 CAATTTGCACAGGGAGAGGGAGG - Intergenic
1012595373 6:101032272-101032294 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1012752826 6:103184591-103184613 CCCTGTGCCCAGGAAGAAAGTGG - Intergenic
1012804716 6:103879295-103879317 CAGTTTGCACAGGGAGAAGGAGG - Intergenic
1012961860 6:105630543-105630565 TAGTGTCCCAAAGGAGAAGGAGG - Intergenic
1012996819 6:105982758-105982780 CAGGGAGCCAGGGGAGAAGGTGG + Intergenic
1013441793 6:110179219-110179241 CTGGGTGCCGAGGGAGACGGCGG - Intronic
1013786744 6:113789733-113789755 CAGTGAGGCCAGGGAGCAGTGGG - Intergenic
1015859054 6:137656486-137656508 CAGTTTGCACAGGGAGCGGGAGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017343885 6:153357228-153357250 CAGTTTGCACAGGGAAAGGGAGG - Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019146168 6:169976794-169976816 AAGTGTGACCAGGGAGGAGGAGG - Intergenic
1019402977 7:866786-866808 CTGAAGGCCCAGGGAGAAGGGGG - Intronic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1019563015 7:1667261-1667283 CAGGCTGCCCAGGGAGGAGCAGG + Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019685622 7:2380333-2380355 CAGAGAGCACAGGGAGGAGGCGG - Exonic
1020051714 7:5086242-5086264 CAGGGGGGCCAGGGACAAGGTGG + Intergenic
1020555427 7:9664201-9664223 CAGTTTCCACAGGGAGAGGGAGG + Intergenic
1021081169 7:16367214-16367236 CAGTGGGCACAGGGAGCAAGGGG - Intronic
1021412270 7:20341983-20342005 AAGTTTGCCCTGTGAGAAGGAGG - Intronic
1021890380 7:25180668-25180690 CAGTGTGGCCAGATAGAGGGTGG + Intergenic
1023862070 7:44222730-44222752 CACTGTGCCCAGCCAGAAGAGGG + Intronic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024185672 7:46945867-46945889 CAGAGTGTCCAGGCAGAGGGAGG + Intergenic
1024326707 7:48114692-48114714 CTGTGTCCTCAGTGAGAAGGAGG - Intergenic
1024438050 7:49382005-49382027 CAGTTTGCACAGGGAGAGAGAGG - Intergenic
1024599543 7:50968099-50968121 CAGTTTGCACAGAGAGAAAGAGG - Intergenic
1025022397 7:55489879-55489901 CAGGGGACCCAGGGAGAAAGTGG + Intronic
1026555733 7:71407280-71407302 AGATGTGCCCAGGGAGAAGGTGG + Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030245854 7:107383995-107384017 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1031976238 7:128095386-128095408 CAAGCTGTCCAGGGAGAAGGTGG - Intergenic
1032528067 7:132594808-132594830 CACTGAGCCCTGGGAGAAGGTGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033460316 7:141541612-141541634 AAGGGAGCCCAGGGAGAAGGAGG - Intergenic
1033866138 7:145692373-145692395 CAGTTTACACAGGGAGAGGGAGG - Intergenic
1034284955 7:149878544-149878566 CTGTGTTCCCAGGGTGAAGAAGG - Intronic
1034427160 7:151020100-151020122 AAGCATGCCCAGGCAGAAGGTGG - Intronic
1034784246 7:153910700-153910722 CAGGAAGCCCAGGGAGAAAGGGG - Intronic
1035324002 7:158052986-158053008 CAGCCTGGGCAGGGAGAAGGCGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035546104 8:483529-483551 CACTGGGCCCAGGGAGCAGAAGG - Intergenic
1035746896 8:1967482-1967504 GGGGGTGCCCAGGGAGGAGGGGG - Intergenic
1036461312 8:8955432-8955454 CATAGAGCCCAGGGAGAGGGAGG + Intergenic
1037816473 8:22115259-22115281 CAGTGAGCCCAGTGAGGATGCGG + Exonic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1038434908 8:27528696-27528718 CAGTGCTCCTAGGGAGAAGGAGG - Intronic
1038919190 8:32063947-32063969 AAGTGTGGGCAGGGAGAATGTGG + Intronic
1039311578 8:36322414-36322436 CAGGGCGGCCACGGAGAAGGCGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039846946 8:41332198-41332220 CACTGTGCCCAGGTAAAAAGTGG - Intergenic
1040758441 8:50808811-50808833 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1041178864 8:55227089-55227111 CAGGGTGCACTGGCAGAAGGTGG - Intronic
1041304720 8:56447062-56447084 GAGGGGGCCCAGGGAGGAGGCGG - Intergenic
1042810956 8:72824558-72824580 GAGTGTGCCTAGGGTGAAGCAGG - Intronic
1043519454 8:81028139-81028161 CTCTGTGCTCAGGGAGAAGTGGG + Intronic
1045115289 8:98974096-98974118 CAGTGTCCCCAGGGAGGCTGCGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1046092644 8:109521203-109521225 TAGAGTGCTCAGGAAGAAGGAGG - Intronic
1047835006 8:128679905-128679927 AAGGGTGTCCAGGGAGAGGGAGG - Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048187022 8:132250736-132250758 CAGAGTGCCCAGTGAGCTGGGGG - Intronic
1048278585 8:133087773-133087795 CAGTGGGGCCAGGCAGCAGGAGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049402547 8:142436051-142436073 CTGTGTGCCCAGGAAGGTGGAGG - Intergenic
1049418982 8:142508537-142508559 CACTCTGCTCAGGGAGAGGGTGG + Intronic
1049742772 8:144249011-144249033 CGGTGTGCTCCAGGAGAAGGTGG + Exonic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050293494 9:4180928-4180950 CAGGATGCCCAGGGAGATGGTGG - Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1050929766 9:11308402-11308424 CAGTTTTCACAGGGAGAAGGAGG - Intergenic
1051768981 9:20555699-20555721 CAGTGTGCCTAGTGAGATGAGGG - Intronic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052832693 9:33228924-33228946 CAGGGGGTCCAGGCAGAAGGTGG - Intronic
1052976048 9:34411040-34411062 CAGTGTGCCCTGGGAGTGGCTGG + Intronic
1052986338 9:34490791-34490813 CAGTGTGTTCAGGGAACAGGAGG + Intronic
1053299980 9:36942061-36942083 CAGTGTGCCCAGGCAGCTGATGG + Intronic
1053543928 9:39003306-39003328 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1053630655 9:39934858-39934880 TGGTTTGCACAGGGAGAAGGAGG + Intergenic
1053654153 9:40198040-40198062 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1053775111 9:41528651-41528673 TGGTTTGCACAGGGAGAAGGAGG - Intergenic
1053808359 9:41826803-41826825 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1053904542 9:42827216-42827238 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054213232 9:62315843-62315865 TGGTTTGCACAGGGAGAAGGAGG - Intergenic
1054366267 9:64344256-64344278 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054530442 9:66178299-66178321 GAGGGTGGCCAGGGAGAAGGGGG - Intergenic
1054622233 9:67360625-67360647 CACTGTGCCCAGGGAGTTGATGG + Intergenic
1054673898 9:67833986-67834008 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1055309555 9:74964589-74964611 CAGTGTGCTCGGGGACTAGGGGG - Intergenic
1055560225 9:77515011-77515033 CAGTGAGGCCTGGGAGAAGCAGG + Intronic
1056130895 9:83585427-83585449 CAATGTGCCCAGGTAAAAAGCGG - Intergenic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1057379702 9:94556270-94556292 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1058281982 9:103127408-103127430 TAGTTTGCACAGGGAGAGGGGGG + Intergenic
1059326418 9:113506541-113506563 CAGTGTGCCCAGGGGTGGGGAGG - Intronic
1059687649 9:116652796-116652818 CAGTGTGCACATGAAGAAAGAGG - Intronic
1060036593 9:120261331-120261353 CAGAGGGGCCAGGGATAAGGCGG + Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1061178543 9:129011177-129011199 CACTGGGCACAGGGAGGAGGCGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061670538 9:132185811-132185833 CTGTGTGTGCAGGGAGGAGGAGG + Intronic
1062348872 9:136129095-136129117 CAGGGAGCCCAGGCAGAGGGTGG + Intergenic
1062551547 9:137089772-137089794 GAGTGGGCCTTGGGAGAAGGAGG + Intronic
1186349198 X:8726463-8726485 CAGAATGCCCAGGGAGAAAGTGG - Intronic
1186985489 X:15009328-15009350 TAGAGTGCAGAGGGAGAAGGTGG + Intergenic
1187526786 X:20061506-20061528 TGCTGTGCCCAGGGAGAAGAGGG + Intronic
1187577597 X:20574962-20574984 CAGTGTGGCCAGGAATAAGGAGG + Intergenic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1189332793 X:40153611-40153633 CAGCGAGCCCAGGGGAAAGGGGG - Intronic
1189549763 X:42080728-42080750 ATGTGTGACCCGGGAGAAGGAGG + Intergenic
1189659277 X:43279440-43279462 CACAGTGCCCATGGAGGAGGAGG + Intergenic
1190877808 X:54471987-54472009 CACTGTGCCCAGCCAGAAGTTGG - Intronic
1192438011 X:71154579-71154601 AAGTCTGCCCAGGGAGAATGGGG + Intronic
1192681076 X:73254594-73254616 CAGTTTACACAGGGAGAAGGAGG + Intergenic
1193508099 X:82367688-82367710 CAGTTTGCACAGAGAGAAAGAGG + Intergenic
1193753637 X:85379268-85379290 CAGTGGGCCCATGAACAAGGTGG - Exonic
1193945036 X:87724313-87724335 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194066326 X:89266724-89266746 CAGTTTGTACAGGGAGAGGGAGG + Intergenic
1194131168 X:90084094-90084116 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194212277 X:91083094-91083116 CATTGTGGGCAGTGAGAAGGAGG + Intergenic
1195328030 X:103773879-103773901 CTCTGTGCTCAGGGAGAAGTTGG + Intronic
1195494163 X:105510391-105510413 CAGTGTGCTCAGTGAGATGTTGG - Intronic
1196520247 X:116663562-116663584 CAGTTTGCACAGGAAGAGGGAGG + Intergenic
1197038715 X:121908545-121908567 CAGTTTGTACAGGGAGAGGGGGG - Intergenic
1197062351 X:122196142-122196164 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197243238 X:124142433-124142455 CAGTTTGCACAGAGAGAAAGAGG + Intronic
1197509268 X:127350698-127350720 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197782765 X:130173398-130173420 CAGTTTGACCAGCAAGAAGGAGG - Intronic
1197874461 X:131088731-131088753 CCGTGTGCCCCGGGAGAAGGAGG + Exonic
1198393809 X:136202970-136202992 CAGTGTGCTCAGGATGAAGTTGG - Intronic
1198397309 X:136233203-136233225 CAGTGAGCACAGGGATAATGGGG + Intronic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic
1200720496 Y:6600843-6600865 CAGTTTGTACAGGGAGAGGGAGG + Intergenic
1201291064 Y:12421176-12421198 CAGTGGGCACGGGGAGACGGAGG - Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic