ID: 903413420

View in Genome Browser
Species Human (GRCh38)
Location 1:23165755-23165777
Sequence ATGCTGTTACAGGTAGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413420 Original CRISPR ATGCTGTTACAGGTAGGACC CGG (reversed) Intronic
903413420 1:23165755-23165777 ATGCTGTTACAGGTAGGACCCGG - Intronic
903574932 1:24333447-24333469 AGGCTGATACAGCTAGAACCAGG - Intronic
903872125 1:26443606-26443628 TTCCTGGTACAGGTAGGAGCTGG - Intronic
905543803 1:38781653-38781675 AGGCTGTTACAGGTATGACCTGG - Intergenic
906880291 1:49582341-49582363 AGGCTGTGACAGCTGGGACCAGG - Intronic
909923481 1:81410609-81410631 ATACTGTTACAGCTAAGGCCAGG - Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
916270717 1:162938655-162938677 TTGCTTTTAAAGGTAGGACCTGG + Intergenic
917591498 1:176480924-176480946 ATGCAGTCACAGGTACGCCCAGG - Intronic
920887877 1:209950070-209950092 ATGCTGTTACAGTTAAGATTAGG + Intronic
923279544 1:232429881-232429903 ATGCAGTTATTGGTAGGACCTGG - Intronic
1066336158 10:34480537-34480559 ATGCTGTTAAAAGTAGAAACAGG - Intronic
1067724992 10:48763108-48763130 ATGTTGTCCCAGGTAGGTCCTGG - Intronic
1070644234 10:78190411-78190433 ATGGTGAGACAGGTGGGACCAGG - Intergenic
1072813414 10:98481503-98481525 CTGCTGACATAGGTAGGACCGGG + Intronic
1079124297 11:17707992-17708014 AGGCTGTTGCAGGCAGGGCCAGG - Intergenic
1081377479 11:42377063-42377085 AAGCTGTAACAGGTGGCACCTGG + Intergenic
1081586685 11:44389772-44389794 ATGCTGTTTCAAGTAGGAGTTGG - Intergenic
1082061142 11:47861177-47861199 ATACTGTTACAGATAGGAAAGGG - Intergenic
1087261516 11:96017617-96017639 TTGCTGGTACAGGTAGGAGTGGG + Intronic
1091760746 12:3085606-3085628 CAGCAGTTACAGGTAGGAGCAGG - Intronic
1098722792 12:73924387-73924409 AAGCTGTGACAGACAGGACCTGG + Intergenic
1106977153 13:35233271-35233293 ATGCTGTTTCAGGTAGTCCTGGG + Intronic
1111807783 13:93059438-93059460 CTAATGTTAGAGGTAGGACCTGG + Intergenic
1113205629 13:107912792-107912814 AAGGTGTCAAAGGTAGGACCAGG + Intergenic
1115020157 14:28670106-28670128 ATTCTGTTGCAGGTAGGGACTGG - Intergenic
1119661331 14:76454135-76454157 CTGCTGCTTCAGGAAGGACCAGG + Intronic
1122777432 14:104127259-104127281 ATGTTGTTGCAGGTACGCCCTGG + Intergenic
1131491907 15:92870360-92870382 ATGCGGTGTCAGGAAGGACCAGG + Intergenic
1131816420 15:96225774-96225796 ATGCCCTTACAGGTAGGCTCCGG - Intergenic
1134055374 16:11166632-11166654 GTGCTGTGACAAGGAGGACCTGG - Intronic
1137032266 16:35534309-35534331 CTGATGTTACAGGTGGGGCCTGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1143380714 17:6494423-6494445 GTGCTGTTCCAGGCAGGGCCAGG - Intronic
1143653610 17:8279853-8279875 AAGCTGTTACAGTTAGGAGAGGG - Intergenic
1149898554 17:60451227-60451249 ATGATGTTAAAGGTAGGAGAAGG + Intronic
1151267496 17:72968032-72968054 ATGATGTTACAGGTTGGATGGGG - Intronic
1154397720 18:14006691-14006713 AAGCTGTTACAGATGGCACCTGG - Intergenic
1158391419 18:57048535-57048557 ATGCTGATGCAGGAAGGCCCGGG + Intergenic
1163263994 19:16207355-16207377 ATGCTGTCACAGGCAGGGCTGGG + Intronic
925237316 2:2291358-2291380 ATGATTTTACAGGTTGGAGCTGG + Intronic
926229174 2:10989966-10989988 AGGCTGATACAGGCAGCACCTGG + Intergenic
930589875 2:53314518-53314540 ATGCTGTGACAAGTAGTAGCAGG - Intergenic
937701258 2:124865608-124865630 ATGCTGATACTGGTGGGACATGG - Intronic
939200150 2:139023446-139023468 TTTCTCTTACAGGTATGACCTGG + Intergenic
941262873 2:163319131-163319153 ATGATGTCACAGCTAGGAACTGG + Intergenic
943031073 2:182686787-182686809 AAGCTGTGACAGATAGCACCTGG + Intergenic
943234544 2:185300692-185300714 ATGCTTTTACAGGAGTGACCAGG + Intergenic
943829028 2:192435061-192435083 ATAGTGTTAGAGCTAGGACCAGG - Intergenic
946181262 2:217950565-217950587 GTGCTGTCCCAGGTAGGCCCTGG + Intronic
946273559 2:218613974-218613996 ATGCTGTGAAATATAGGACCTGG - Intronic
946766706 2:223047265-223047287 CTGGTGTTACAGGGAGGGCCTGG + Intergenic
948667046 2:239542649-239542671 ATGGTATTAAAGGTAGGGCCAGG - Intergenic
1169066782 20:2698330-2698352 ATGCTTGCACAGGGAGGACCTGG - Intronic
1173628193 20:44489422-44489444 ATGCTGTCACAGGCAGGAACAGG - Exonic
1174483588 20:50847750-50847772 ATTCAGTTACAGGTGGGACACGG + Intronic
1174804965 20:53597040-53597062 ATGCTGTGACTGGCAGGATCTGG - Intronic
1179517325 21:41917706-41917728 GAGCTGTTGCAGGCAGGACCAGG + Intronic
1179908098 21:44434563-44434585 TTGCTGTTTCATATAGGACCTGG + Intronic
1182503329 22:30764381-30764403 ATCCTCTAACAGGTAGGACTTGG + Intronic
1184268619 22:43364527-43364549 ATGATGATAATGGTAGGACCTGG + Intergenic
954196331 3:48999238-48999260 ATGCCTTGACAGGTAGGACAGGG - Intronic
956753827 3:72366485-72366507 TTGCTGTTCCAGGTTGGCCCTGG - Intergenic
959655679 3:108801557-108801579 CTAATGTTGCAGGTAGGACCTGG - Intergenic
961604432 3:128083184-128083206 ATGCTGTAACACGGTGGACCAGG + Intronic
962398544 3:135038338-135038360 ATGCTGTTAAAGGCAAGACTCGG - Intronic
962732549 3:138296960-138296982 ATGCTGTTTCAGGAAGCACAAGG - Intronic
967639300 3:191841824-191841846 GTACTATTAAAGGTAGGACCTGG - Intergenic
967671877 3:192246476-192246498 AGGCTTTTCCAGGTAGGACCTGG + Intronic
967965829 3:194959605-194959627 AGGCTGTTCCAGCTAGCACCTGG - Intergenic
976646098 4:87389146-87389168 ATGCTGGTCCAGGCTGGACCTGG + Intronic
978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG + Intronic
978810089 4:112840097-112840119 CTGCTGTTAGAGGAAGGACAAGG - Intronic
978952290 4:114575461-114575483 ATGCTGTTATAGGCAGGGCATGG - Intergenic
986637089 5:9834091-9834113 ACGCTCTTCCAGGTAGGGCCTGG - Intergenic
989597497 5:43170599-43170621 ATGCTGTTACAGGTAAGTTGGGG - Intronic
991930706 5:71750490-71750512 ATGAGGTTACAGCTAGGAACTGG + Intergenic
996435214 5:123426522-123426544 ATTCTGTTAGAGGAAGCACCAGG - Intergenic
997329592 5:133050509-133050531 ACCCTTTTACAGGTAGCACCTGG + Intergenic
1004654886 6:17649861-17649883 CTGCAGTTTCAGGTATGACCTGG + Intronic
1007937365 6:45744851-45744873 ATGCCGTCAGATGTAGGACCAGG - Intergenic
1013890328 6:115019310-115019332 ATGCTGTTACAGAAATGAGCAGG - Intergenic
1013914832 6:115323731-115323753 TTGCTATTACATGTAGGACAAGG - Intergenic
1015864061 6:137709972-137709994 ATCCTGTTACAGGTTGCCCCAGG - Intergenic
1029013252 7:97285313-97285335 ATGTTGTTACAGGAAGCACTAGG - Intergenic
1029379090 7:100200958-100200980 GAGCTGTTACAGGTAGGAGCTGG + Exonic
1030712604 7:112768457-112768479 ATTCTTGTACAGGTAGGAACAGG - Intronic
1031301019 7:120060778-120060800 GTGCTGTAACAGGGAGGACATGG - Intergenic
1031344746 7:120651499-120651521 AAGCTGTGACAAGTGGGACCTGG - Intronic
1034540830 7:151756872-151756894 ACCCTCTTCCAGGTAGGACCCGG + Intronic
1035069308 7:156129689-156129711 ATGCAGATGCAGGGAGGACCAGG - Intergenic
1038851934 8:31287421-31287443 ATGCTGTCACAAGAAGGACCAGG + Intergenic
1039707461 8:40022284-40022306 AAGCTGTGACAGGCAGCACCTGG - Intergenic
1042737183 8:72002562-72002584 AGGCGGTTACAGGTAGGAGCTGG - Intronic
1043938890 8:86174276-86174298 ATGCTGTGACAGATGGTACCTGG - Intergenic
1044006157 8:86939394-86939416 ATTCTGTTACATGTAGAACTTGG - Intronic
1045847997 8:106659499-106659521 ATCCTCTTAAAGGTGGGACCAGG + Intronic
1046058154 8:109103211-109103233 ATGCTGATAAAGGAAAGACCTGG - Intronic
1047406707 8:124591225-124591247 TTGCTTTTTCAGGTGGGACCAGG - Exonic
1048416125 8:134229673-134229695 ATGCTGTTAAGGGGAAGACCAGG - Intergenic
1049985980 9:951854-951876 ATTCTGTTTCAGGTAGTCCCTGG + Intronic
1052294751 9:26884458-26884480 ATGCTGTTTAATGTAGTACCTGG + Intronic
1052842053 9:33300351-33300373 AGGCTGTAACAGGTTGGACACGG - Intronic
1061804311 9:133129453-133129475 CTGCTGTGACAGGCAGGACCAGG + Intronic
1187808386 X:23147015-23147037 ATGCTATTACAAGTAAGAGCTGG + Intergenic
1187972349 X:24671617-24671639 ATGCTGGTACAGGAAAGACCAGG + Intronic
1187977445 X:24717479-24717501 ATGCTCTTACAAGTAGGACACGG - Exonic
1192104363 X:68299568-68299590 ATGATGATACAGGTACCACCTGG + Intronic
1193592487 X:83407375-83407397 AAGCTGTAACAGATAGTACCTGG + Intergenic
1195571996 X:106407267-106407289 AAGCTGTGACAGGTGGTACCTGG + Intergenic