ID: 903413774

View in Genome Browser
Species Human (GRCh38)
Location 1:23168103-23168125
Sequence GGCCGCGCCGGCCCGCGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413774_903413777 -9 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413774_903413778 -3 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413778 1:23168123-23168145 GCCGACAGCTGCGGCGGCCGCGG 0: 1
1: 0
2: 3
3: 34
4: 420
903413774_903413783 21 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413783 1:23168147-23168169 ACCCCTCCCCGCCCGGCCCGCGG 0: 1
1: 0
2: 6
3: 71
4: 508
903413774_903413782 14 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413782 1:23168140-23168162 CCGCGGGACCCCTCCCCGCCCGG 0: 1
1: 0
2: 6
3: 23
4: 254
903413774_903413780 -2 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413780 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413774 Original CRISPR GGCCGCGCCGGCCCGCGTCC CGG (reversed) Intronic