ID: 903413774

View in Genome Browser
Species Human (GRCh38)
Location 1:23168103-23168125
Sequence GGCCGCGCCGGCCCGCGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413774_903413782 14 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413782 1:23168140-23168162 CCGCGGGACCCCTCCCCGCCCGG 0: 1
1: 0
2: 6
3: 23
4: 254
903413774_903413777 -9 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413774_903413778 -3 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413778 1:23168123-23168145 GCCGACAGCTGCGGCGGCCGCGG 0: 1
1: 0
2: 3
3: 34
4: 420
903413774_903413780 -2 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413780 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 17
4: 230
903413774_903413783 21 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413783 1:23168147-23168169 ACCCCTCCCCGCCCGGCCCGCGG 0: 1
1: 0
2: 6
3: 71
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413774 Original CRISPR GGCCGCGCCGGCCCGCGTCC CGG (reversed) Intronic
901506535 1:9689296-9689318 GGCCCCGCCTGGCAGCGTCCTGG + Intronic
901556072 1:10032643-10032665 GGTGGCGCTGGCCCGCGGCCCGG - Intergenic
901637856 1:10678583-10678605 GGCCGCGCCGGCTCGCGCAGGGG + Intronic
902072121 1:13749269-13749291 CGCCGCTCCCGCCCGCGTCCCGG + Intronic
902169585 1:14599127-14599149 GGCGGCCCCGGCCCGGGCCCGGG + Exonic
902509922 1:16960973-16960995 GGCCGAGCTGGCCCGCGTGGAGG + Exonic
903184668 1:21622414-21622436 GGCCGGGCCGGGCCGCGCTCAGG - Intronic
903184692 1:21622477-21622499 GCCCGCGCGCGCCCGGGTCCGGG + Intronic
903263481 1:22143246-22143268 CGCCGCTCCGGCCCGCCCCCGGG - Intronic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
903925222 1:26826901-26826923 GGCGGCGCGGGCCCGGGGCCCGG - Exonic
904003211 1:27350100-27350122 GGCGGCGCCGGGCGGCGGCCAGG - Exonic
904037891 1:27568595-27568617 GGCCGCGCGGGCCGGGCTCCCGG + Intronic
904039470 1:27575738-27575760 GGCCGCCCCTTCCCGCGCCCCGG + Intronic
904251848 1:29230774-29230796 CGCCGAGCCTGCCCGGGTCCGGG - Exonic
904259947 1:29282769-29282791 GGCGGCGCTGGCCCGAGGCCTGG + Exonic
905105441 1:35560937-35560959 GGCCGGGCTGGCACGCATCCTGG + Exonic
905107758 1:35574250-35574272 GGCACCGCCCGCCCGCGCCCTGG + Exonic
905867142 1:41382483-41382505 CGCCGCGCCCGACCGCTTCCCGG + Exonic
908534685 1:65066871-65066893 CCCCGCCCCCGCCCGCGTCCAGG - Intergenic
910288145 1:85576880-85576902 CGCCGCGGCGGCCCGCGCCCAGG - Intronic
910450100 1:87335388-87335410 GGCGGCGCCGGCCCGGGTGCTGG - Intronic
911133807 1:94418345-94418367 GGCCGCGCAGGACCGCCCCCTGG - Intergenic
913592550 1:120342351-120342373 AGCCCCGGCGGCCCGCGGCCGGG - Intergenic
913650800 1:120912779-120912801 AGCCCCGGCGGCCCGCGGCCGGG + Intergenic
914170312 1:145216288-145216310 AGCCCCGGCGGCCCGCGGCCGGG - Intergenic
914525430 1:148460254-148460276 AGCCCCGGCGGCCCGCGGCCGGG - Intergenic
914598244 1:149175576-149175598 AGCCCCGGCGGCCCGCGGCCGGG + Intergenic
914640971 1:149606874-149606896 AGCCCCGGCGGCCCGCGGCCGGG + Intergenic
915238258 1:154501791-154501813 GGCGGCGCTGGGCCGGGTCCTGG - Exonic
915549406 1:156623877-156623899 GGCCACGCTGCCCTGCGTCCTGG + Exonic
917028323 1:170664775-170664797 AGCCCCGCCGCCCCGCGTGCGGG - Intronic
921155074 1:212432982-212433004 GGCAGCGCTGGCCCTGGTCCTGG + Exonic
924715225 1:246566691-246566713 GGACCCGCCGGCTCGCGGCCGGG + Intronic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1063200886 10:3784857-3784879 AGCCGACCCGGCCCGCGCCCCGG + Intronic
1069761689 10:70815901-70815923 GGCCGCGCACGCCAGGGTCCGGG + Intergenic
1074815141 10:117137171-117137193 GGCGGCGCCGGGCCGGGGCCCGG + Intronic
1074865818 10:117543779-117543801 GGGCGCGCTGGCCCGCGAGCCGG - Intronic
1075401408 10:122163826-122163848 GGGCGAGCCGGCCGGCGGCCGGG - Intronic
1076372295 10:129963581-129963603 GGCCGGGCCGGGCCGGGGCCGGG + Intronic
1076895382 10:133308918-133308940 GGCTGCGCCCGCCCGCGCCCGGG + Exonic
1076905190 10:133357825-133357847 GGCCGGGAAGGGCCGCGTCCTGG - Intronic
1077021003 11:417142-417164 GCCCGAGCTCGCCCGCGTCCTGG - Intronic
1077024524 11:433324-433346 GGCCGCGCCGACCACCATCCCGG - Exonic
1077275682 11:1706477-1706499 GGCCTGGCCTGCCCCCGTCCTGG + Intergenic
1077316040 11:1919787-1919809 GGCCCCGTCGGCCCCAGTCCTGG - Intronic
1078210373 11:9265257-9265279 GGCCGCCCCGCACCGCATCCTGG + Exonic
1079064365 11:17276705-17276727 CGCCGCGCGCGCCCGCCTCCTGG - Intronic
1082986187 11:59172695-59172717 GTCCGCGCCGGCCCCCGCGCGGG + Exonic
1083448492 11:62726943-62726965 GGCCGCGTCGGGCGGCGGCCCGG - Exonic
1084086304 11:66856904-66856926 GCCCGCGCCGGCCCGGGCCTCGG + Intronic
1084175591 11:67420755-67420777 GGCCGCGCTGGCCGCCGTGCTGG + Exonic
1084310464 11:68313282-68313304 GGCCAGGCCGCCCCGCGCCCGGG - Intronic
1084588765 11:70078478-70078500 GGCCGGGCCTCCCCGCGCCCAGG - Exonic
1090799242 11:130160207-130160229 AGCCCCGCCCGCCCGCGGCCCGG - Intronic
1091558652 12:1594358-1594380 GGCGGCGGCGGCCGGCCTCCGGG - Intronic
1094375492 12:29784031-29784053 GGGGGAACCGGCCCGCGTCCCGG - Intronic
1095949355 12:47773446-47773468 CCCCGCGCCGCCCAGCGTCCCGG - Intronic
1098369304 12:69739405-69739427 GGCCGCGCCCGCCCGCCGCCAGG - Exonic
1098773922 12:74588323-74588345 GGTCGCGACCCCCCGCGTCCGGG - Intergenic
1103534725 12:121626709-121626731 GCCCGGGCCGGCCCGCGCCTCGG + Exonic
1103809395 12:123601799-123601821 GGCAGCACAGGACCGCGTCCAGG - Intergenic
1104568241 12:129903784-129903806 AGCCGCCTCTGCCCGCGTCCCGG - Intergenic
1105031509 12:132887460-132887482 GGGGGCGCCCGCCGGCGTCCAGG - Intronic
1105349392 13:19602080-19602102 GGCCGCCCCGGCCGGCTACCCGG + Intergenic
1107481513 13:40789588-40789610 GGCCGCCCCAGCCGGCGACCCGG + Exonic
1112290645 13:98142517-98142539 CCCCGCGCCCGCCCACGTCCTGG - Intergenic
1115028239 14:28766844-28766866 GGACGCGCCCGCCCGCCGCCCGG + Intergenic
1115028418 14:28767533-28767555 GGCCGGGGCGCCCCGCGTCTGGG - Exonic
1116887017 14:50231559-50231581 GGCGGCGCTGGCCCGCTTCTGGG + Intergenic
1117424719 14:55581240-55581262 GGACGCCGCTGCCCGCGTCCGGG - Intronic
1120993497 14:90397943-90397965 GGCCGGGCCGCCCTGCGCCCGGG + Intronic
1121127547 14:91417788-91417810 GGCTGCGGCGGCTCGCGCCCGGG + Intronic
1121246015 14:92461241-92461263 GGCCACGAAGGCCAGCGTCCTGG - Intronic
1121312305 14:92941758-92941780 GGCCGAGCCGGCGGGCGGCCTGG - Exonic
1122975533 14:105169200-105169222 GGCCGCGCCACCCCGCGTGGGGG - Intergenic
1123630802 15:22258322-22258344 GCCCGCGCCGCGCCGCGCCCCGG - Intergenic
1126100273 15:45114524-45114546 GGACGCGCTCTCCCGCGTCCAGG + Exonic
1126786170 15:52179565-52179587 GGCCCCACCGCCGCGCGTCCCGG + Intronic
1128067656 15:64774974-64774996 GCGCGCGCCGGCCGCCGTCCGGG - Intronic
1129539402 15:76338469-76338491 CGCAGCCCCGGCCCGCTTCCCGG + Exonic
1129676143 15:77633170-77633192 GGCCGCGCCCCTCCGGGTCCGGG + Intronic
1129983660 15:79897126-79897148 CGCGCCGCGGGCCCGCGTCCCGG - Intronic
1130102306 15:80903285-80903307 GGCCGAGCCTCCCCGCCTCCAGG - Intronic
1132320108 15:100919397-100919419 GTCCGCCCGGCCCCGCGTCCCGG + Exonic
1132639285 16:970462-970484 GGCGGGGCCGGCCCGGGCCCTGG - Intronic
1132884916 16:2178399-2178421 GGGCGCCCCGGCCCGGGTCCAGG + Exonic
1136245796 16:28975119-28975141 GGCCGCGCCCGCCCGCGCTCCGG - Exonic
1138561324 16:57802409-57802431 GGCCGGGCCGGGCCGAGCCCCGG - Exonic
1139750535 16:69106749-69106771 GGCCGCGGCAGCACGTGTCCGGG + Intronic
1139778240 16:69330450-69330472 GGCCGCCCCGGACGGCGTCGAGG - Exonic
1141841455 16:86576730-86576752 GGCCGCGCCCGCCTAGGTCCTGG - Intronic
1141972240 16:87492245-87492267 GCCCGCGCCGCGCCGCGACCCGG + Intergenic
1142214190 16:88822766-88822788 GGCCTCGTCTGCCCGTGTCCTGG + Intronic
1142474609 17:181499-181521 CGCCGGGCCGGGCCGCGCCCGGG - Exonic
1142854956 17:2724283-2724305 GGCCGCCTCGCCCCGCTTCCTGG + Intergenic
1143635672 17:8162714-8162736 GGCCGAGGAGCCCCGCGTCCCGG - Intronic
1143741757 17:8959598-8959620 GGCCGAGCCAGCCAGCCTCCTGG - Intronic
1143904629 17:10198755-10198777 GGCGGCCCCGGCCCCGGTCCCGG - Intergenic
1144756130 17:17681680-17681702 GGCCCGGCCGGCCCGCGGCCAGG - Exonic
1144847050 17:18225563-18225585 GGCCCCGCGCGCCCGCGCCCGGG + Intergenic
1146132685 17:30292135-30292157 GGCCGCGCCTGCCCCCGCGCAGG + Intergenic
1146197339 17:30824703-30824725 GGCCGCGCCGGGCCGCTTGGAGG - Exonic
1146433645 17:32822613-32822635 TGGCCCGCCGGCCCCCGTCCCGG + Intronic
1146957215 17:36942694-36942716 GGTCCCGCCGGCCCCCGGCCGGG + Intronic
1147648862 17:42050668-42050690 GCCAGCGCCGGCCAGGGTCCCGG + Intronic
1147954229 17:44123439-44123461 GGGGGCGCCGCCTCGCGTCCCGG + Intronic
1148370978 17:47099953-47099975 CGCGGCCCCGGCCCGCCTCCTGG + Intergenic
1148865543 17:50626378-50626400 GCCAGCGCCGGCCTACGTCCTGG + Exonic
1150764627 17:67993552-67993574 GGCGGCGCGGGCGCGGGTCCCGG + Intronic
1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG + Intronic
1152617806 17:81345953-81345975 GGCGGCGGCGGCCGCCGTCCGGG + Intergenic
1152769032 17:82156421-82156443 GGAGGCGCCCGCCCGTGTCCGGG + Intronic
1152923975 17:83079383-83079405 GGCCGCGCCGGGCGGCGAGCGGG - Intergenic
1153040947 18:812417-812439 GGCCACGCCGGCCCGGCTCCGGG + Exonic
1153219190 18:2847270-2847292 TGCCACGCCGGCCCGCAGCCCGG + Exonic
1153457322 18:5295573-5295595 GGCCGCGCGGGCCGGCGAGCGGG - Intronic
1158453422 18:57586627-57586649 GGCAGCCTCGGCCCGAGTCCGGG + Exonic
1158718239 18:59899779-59899801 GGCGGCGCCGACCCGCGGCGGGG - Intergenic
1160237795 18:77099637-77099659 GGCCGGGCCTGCCCGAGGCCAGG - Intronic
1160703630 19:519252-519274 CGCCGCGCCCGCGCGCTTCCTGG + Exonic
1160853553 19:1206059-1206081 CGCCGCGCCGCCCCGCGGACCGG + Intronic
1160860928 19:1237006-1237028 GGCTGCGCCGCACAGCGTCCAGG - Intronic
1160865833 19:1255579-1255601 GGCCTCACCGGCCCCCGACCTGG + Exonic
1160937751 19:1605249-1605271 GGCCGGGCCGGGCCGGGCCCAGG - Intronic
1161265179 19:3360388-3360410 GGGCGCGCCGGGCCGAGACCCGG - Intronic
1162046809 19:8005494-8005516 GGGCCCGCCCGCCCGCATCCAGG - Exonic
1162046847 19:8005643-8005665 ACCCGCTCCGGCCCGCGGCCCGG + Intronic
1162113355 19:8413346-8413368 GGCCGGGCCGGGCCGGGACCGGG + Intronic
1162907071 19:13830459-13830481 GGACGCGGCGGCCGGCGGCCTGG + Exonic
1163807110 19:19405998-19406020 GGCCCGGCCGACCCGCGGCCCGG + Intronic
1164952088 19:32345529-32345551 GGCCCCGCCTACCGGCGTCCCGG - Intergenic
1164958444 19:32406090-32406112 GCCCAGCCCGGCCCGCGTCCCGG - Intronic
1165243070 19:34482344-34482366 GGTCGCTCGGACCCGCGTCCCGG + Exonic
1166857921 19:45792482-45792504 GGCAGGGCGGGCCCGGGTCCGGG + Exonic
1167070930 19:47221652-47221674 GGCTGCCCCGGCCCGCCCCCGGG + Exonic
1167284100 19:48589123-48589145 GGCGGCGCTGGCCGGGGTCCAGG + Intronic
1167428420 19:49441430-49441452 GGCCGCCCGGGCCCGCGGGCGGG - Exonic
1167579575 19:50333537-50333559 GGCTGCGCCCGCCCCCGTCAGGG + Intronic
1167583081 19:50357908-50357930 GGCTGCGCCCGCCCCCGTCAGGG + Intronic
1168645917 19:58059352-58059374 GGCCGGGCCGGGCCGGGTGCGGG + Intronic
925358942 2:3263681-3263703 GGCCGCACCGTGCCGCGTCCTGG - Intronic
925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG + Intronic
925730535 2:6917320-6917342 GCCTGCGCCGGCCCGAGGCCCGG - Intergenic
927591314 2:24360367-24360389 CCCCGCGCCTGCCCGCGCCCAGG - Exonic
927714286 2:25342112-25342134 GGCCGCGCTGGCCCCGGCCCCGG + Intronic
928093760 2:28392132-28392154 GCCCGCGCCGCCCTGCGGCCGGG - Intergenic
931036624 2:58251475-58251497 GGCCACGCCAGCCCCAGTCCCGG + Intergenic
931348731 2:61470530-61470552 GGCCGGGCCGGGCGGCGTGCGGG - Intronic
931649333 2:64454276-64454298 AGCCCCGTCGGCCCGGGTCCGGG + Exonic
931868266 2:66434187-66434209 CGCCGCGCCGCGCCGCGCCCTGG + Intronic
934501194 2:94861620-94861642 GGCCGCGAGGTCCCGCGTCTGGG - Intergenic
935196687 2:100820393-100820415 GGCCGCTCCGGCCCGCTCCGAGG + Exonic
935645317 2:105329643-105329665 TCCCGCGCCGCCCCGCGGCCTGG + Exonic
937221559 2:120345496-120345518 GGCCGCGCGGGCCCGCTCACAGG - Intergenic
941384922 2:164841345-164841367 GCCCCGGCCGGCCCGCCTCCCGG + Exonic
944221657 2:197310209-197310231 GGCGCCGCCGGCCCGGGCCCCGG - Intronic
946250130 2:218406534-218406556 TCCCGCCCCGCCCCGCGTCCGGG + Intergenic
948257135 2:236576681-236576703 GGCCGCCCCAGCCTGCGTGCAGG - Intronic
948801469 2:240435409-240435431 GGCAGCGCGGGGCCGCGGCCGGG - Intergenic
1168760482 20:347048-347070 GGGGGCGCCGGCCCGCCTCAGGG - Exonic
1168795908 20:610087-610109 GGCCGCGCCGCGCCGCCTCCGGG + Exonic
1170890058 20:20368795-20368817 CGCCGAGGCGGCCCGCGGCCCGG + Exonic
1171444824 20:25195880-25195902 GGCCGCCCCCGCCAGCGCCCCGG - Intronic
1174287309 20:49482598-49482620 GGCCCCGCGGGCGCGCGTCACGG + Exonic
1175847202 20:62065287-62065309 GCCCGCGCCGGCCCCGGCCCCGG - Exonic
1175856127 20:62122058-62122080 GGCGGCGCCGGCACGCGCGCGGG + Intergenic
1175856131 20:62122065-62122087 GGCCCCGCCCGCGCGCGTGCCGG - Intergenic
1175890799 20:62315067-62315089 GGCCCCGCAGGCCCTCGTACTGG + Exonic
1176549014 21:8213569-8213591 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176556905 21:8257783-8257805 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176567943 21:8396601-8396623 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176575847 21:8440820-8440842 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1178992605 21:37367641-37367663 GGCCGGGCGGGGCCGCGGCCGGG - Intronic
1179882739 21:44300280-44300302 GGCCGGGCCGGCCCGAGACCCGG - Intronic
1180039044 21:45266396-45266418 GGCCGCGCCGGCCCGGAGGCAGG + Intronic
1180235874 21:46459109-46459131 GGCCAGGCCGGCTAGCGTCCGGG - Exonic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1180950378 22:19718192-19718214 GCCCGCCCCGGCCCGCGTGCAGG + Intronic
1181082927 22:20426064-20426086 GGCCCGGCCGGCCCGGGCCCGGG - Exonic
1181085151 22:20436469-20436491 GGCCAGGCCGGCCCCCGCCCCGG + Intronic
1182435437 22:30326834-30326856 GGCCGCGCGCGCCCGCGGCCGGG - Exonic
1182578679 22:31291034-31291056 GCCCGCGCGGGTCCTCGTCCGGG + Exonic
1183788433 22:40045300-40045322 GGGCGCCCCGGCCCGCGCGCCGG - Intronic
1185349470 22:50327020-50327042 GGCGGGGGCGGCGCGCGTCCGGG + Exonic
1185398516 22:50604447-50604469 GGCCCCGCCGGCCGGCGACACGG - Exonic
1203253898 22_KI270733v1_random:129878-129900 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203261954 22_KI270733v1_random:174957-174979 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
949461969 3:4303505-4303527 GGCCGCGCCGGCGCCCTTCCAGG + Exonic
949709947 3:6861472-6861494 GGCGGCGGCGGCGCGCGGCCAGG + Exonic
951611324 3:24495098-24495120 GCCCGCCCCGGCCCGCTTCCCGG + Intronic
952816626 3:37452578-37452600 GGCCGCGCGGGCCAGGGTCGCGG - Intronic
952816693 3:37452766-37452788 GGACGCCCCCGCCCGCCTCCAGG - Intronic
954277955 3:49554657-49554679 GGCGGCGCCGGCCCCGGCCCGGG + Exonic
954632918 3:52056616-52056638 GGCCGCGGGGGCCGGCGCCCGGG + Intergenic
954838897 3:53494525-53494547 GCCCGCGCCGCGCCGCGCCCCGG - Intergenic
956892206 3:73624102-73624124 GGCCGCGCCGCCCGGCGGCAAGG - Exonic
959539500 3:107523548-107523570 GGCCGCTCCAGCCCGCGCCCCGG - Intronic
961377329 3:126475692-126475714 GGCCTCCCCGGGCCGCGCCCCGG + Exonic
961827446 3:129606498-129606520 GGCGGCGCGGGCCGGCGCCCTGG - Exonic
962738906 3:138348804-138348826 GGCCGCGCCGCCTCTCGCCCCGG + Intronic
966919331 3:184601926-184601948 GGCGGAGCCGGCCCCCGGCCCGG - Intronic
968506449 4:973364-973386 GGCCGCGCGCGCCCGGGGCCGGG - Exonic
968604250 4:1524328-1524350 GGCCGCGCCAGCCGTCCTCCTGG + Intergenic
968604281 4:1524514-1524536 GGCCGCGCCAGCCGTCCTCCCGG + Intergenic
968702647 4:2064180-2064202 GGCCGCGCCGGGCGGCGGGCAGG - Exonic
970333324 4:15004763-15004785 CGCCGCGCCTCCCCGCGTCGGGG - Intronic
972396846 4:38664748-38664770 GGCAGCGCCCGCCGCCGTCCCGG + Intronic
973931070 4:55793690-55793712 GGCCGCGCCCGCCCGGGGCGAGG - Intergenic
980920745 4:139083691-139083713 GGCCGCTGCTGCCCGCGTTCGGG - Intronic
983238611 4:165207378-165207400 GGCGGCCGCCGCCCGCGTCCCGG + Intronic
985005943 4:185535487-185535509 CTCCGCGCCGGGCGGCGTCCTGG + Exonic
985280696 4:188283139-188283161 CCTCGCGCCGGCCCGCGGCCAGG + Intergenic
986704202 5:10441865-10441887 GGCGGGGCCTGCTCGCGTCCCGG + Exonic
992473268 5:77077778-77077800 GTCGGCGCCGGCCCCAGTCCCGG + Exonic
997980612 5:138465589-138465611 GTCCACGCCCGCCCGCGCCCAGG + Exonic
999790752 5:154937763-154937785 GGCCGAGCGGTCCCGCCTCCTGG - Intronic
1001159532 5:169300978-169301000 GGCCCCGCTGGCCCGCGGGCCGG + Intronic
1002067429 5:176658967-176658989 GGCCCCGCTGGCCAGTGTCCTGG + Exonic
1002638388 5:180619196-180619218 GCCCGCGGCGCCCCGCGCCCGGG + Intronic
1002897833 6:1389665-1389687 GGCCGCTCGGCCCCGCGGCCTGG + Intergenic
1002926779 6:1609711-1609733 GGCCGCCCTGGCCCGGGCCCCGG - Intergenic
1003871177 6:10404465-10404487 GCCCGCCCCGCCCCGCGGCCGGG - Intronic
1003872358 6:10412934-10412956 GCGCGCCCCGGCCCGCATCCCGG - Intronic
1006366921 6:33621422-33621444 GGCCCCGCCGAGCCGCCTCCTGG + Exonic
1006671485 6:35732096-35732118 GGCCGCGCCTTTCCCCGTCCCGG - Intergenic
1015149249 6:130019930-130019952 CGCCGCGCCGGCCCGGGTGCGGG + Intronic
1015251887 6:131135699-131135721 GGCGGTGGCGGGCCGCGTCCCGG - Exonic
1016590083 6:145735086-145735108 GGCCCCGGCGGCGCGCGTCCCGG - Intronic
1016949487 6:149566349-149566371 GGCGGAGCCGGCCCGCGGGCGGG - Exonic
1019269635 7:139758-139780 GGCCCCACCGGCCAGTGTCCTGG - Intergenic
1019577652 7:1745289-1745311 GGCCGCGGCGGCCCTGGCCCAGG - Exonic
1020125445 7:5530463-5530485 GGCCGCGGCCGCCTGCGGCCGGG + Intronic
1025639030 7:63350020-63350042 GGCCACGCCGCGCCGCGTCCGGG - Intergenic
1025643669 7:63398072-63398094 GGCCACGCCGCGCCGCGTCCGGG + Intergenic
1028621425 7:92833328-92833350 CGCCGCGGCGGGCGGCGTCCAGG - Exonic
1033756929 7:144403696-144403718 GGCCGCGGCGGCGGGAGTCCAGG - Intronic
1034470478 7:151251950-151251972 GCCCGCGCCGGTCCCCGGCCTGG + Intronic
1035061192 7:156070840-156070862 GGCTGCCCCGCCCCGCATCCTGG + Intergenic
1035387646 7:158485016-158485038 GGCCCCGGCCGCCAGCGTCCCGG + Intronic
1036195298 8:6708559-6708581 GGGCGCGGCGGCCCGGGCCCGGG + Exonic
1037581859 8:20250048-20250070 GGCCGCCCTGGCCCGCGACATGG - Exonic
1037865746 8:22441092-22441114 GGCCGCGGCTGCTCGCGGCCCGG - Intronic
1037977654 8:23224820-23224842 TCCCGCGCCGGCCTGGGTCCTGG + Exonic
1038664154 8:29522926-29522948 GGCCGCGTGGGCCAGCGTCCTGG - Intergenic
1039893784 8:41701932-41701954 GGCGCCTCCGACCCGCGTCCCGG + Intronic
1039921306 8:41896257-41896279 CGCCGCGCCCCACCGCGTCCCGG + Intronic
1039979154 8:42391943-42391965 GGCCGCGCGGGCTCCAGTCCCGG + Intronic
1046770359 8:118111672-118111694 AGCCGGGCCGCCGCGCGTCCCGG - Exonic
1049240787 8:141536483-141536505 GGCCTCGCCGGCCCCTCTCCAGG - Intergenic
1049620946 8:143598022-143598044 GGCCACGCGGGGCCGCGGCCCGG - Exonic
1049682966 8:143927883-143927905 GGCCGTGCCGGCCACCCTCCCGG - Exonic
1053399056 9:37801199-37801221 GGCCGCCCAGGCCCGCGCCGAGG - Exonic
1053409137 9:37904258-37904280 CGCCGCGGCGGCCTGCGGCCAGG - Intronic
1054775636 9:69121635-69121657 CGCCGCGCCGCCCAGCGCCCCGG + Intronic
1055611698 9:78031343-78031365 CGCCGCCCGGGCGCGCGTCCGGG + Exonic
1056643195 9:88388339-88388361 GGCCGCGCCGCCCCGGCGCCTGG - Intergenic
1057773353 9:97985073-97985095 GCCCGCGCCGGTCCGCGGCGGGG - Intronic
1060811761 9:126614347-126614369 GGCCGCGCCTCCCCGGTTCCAGG + Intergenic
1060980022 9:127786367-127786389 GGCCGCGCCGCACCCCGCCCCGG + Intronic
1061472104 9:130835161-130835183 GGCCGCGCCCGTCCGCACCCAGG - Intronic
1061837018 9:133336206-133336228 GGCCGCGCCTGCCCGTGTGGTGG - Exonic
1062325698 9:136011552-136011574 GGCCGCGGCCGCCGGCGTCTGGG + Exonic
1203793145 EBV:162218-162240 GGCCCTGCAGGGCCGCGTCCAGG + Intergenic
1203470298 Un_GL000220v1:113022-113044 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203478119 Un_GL000220v1:156994-157016 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1186426306 X:9465911-9465933 GGGAGGGCCGGCCCGCGTCCCGG - Intronic
1186496551 X:10015906-10015928 GGTGGCGCCGGCCGGCGGCCCGG - Intronic
1187403813 X:18984661-18984683 GGCGGCCCCGCCCCGCGCCCTGG + Intergenic
1187464593 X:19515607-19515629 GGCAGCGCCCGCCCGCAGCCGGG + Intergenic
1187900907 X:24025753-24025775 GCCCGCGGCGCCCCGCGTCCCGG + Intronic
1192436077 X:71144793-71144815 GACCGCGCCCCCCCGTGTCCGGG + Intergenic
1195625211 X:106999908-106999930 GGCCGGGCCAGCCCGCAGCCCGG + Exonic
1198312681 X:135436886-135436908 GGCCGAGCTGGCCCGCGTGGAGG + Intergenic
1198750466 X:139932694-139932716 TGCCGCGCCGCCCCGCGCTCTGG + Intronic
1200093865 X:153648199-153648221 GCCGGCGCCGGCCCCCGCCCTGG - Exonic
1200128959 X:153830780-153830802 GGCGGCCCCCGCCCGCGGCCAGG + Intergenic