ID: 903413777

View in Genome Browser
Species Human (GRCh38)
Location 1:23168117-23168139
Sequence GGCGCGGCCGACAGCTGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413768_903413777 3 Left 903413768 1:23168091-23168113 CCAGCAGAGCGCCCGGGACGCGG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413765_903413777 23 Left 903413765 1:23168071-23168093 CCAGCGGTCTGGCTGCGAGACCA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413764_903413777 24 Left 903413764 1:23168070-23168092 CCCAGCGGTCTGGCTGCGAGACC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413763_903413777 28 Left 903413763 1:23168066-23168088 CCGGCCCAGCGGTCTGGCTGCGA 0: 1
1: 0
2: 0
3: 16
4: 129
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413773_903413777 -8 Left 903413773 1:23168102-23168124 CCCGGGACGCGGGCCGGCGCGGC 0: 1
1: 0
2: 1
3: 31
4: 298
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413762_903413777 29 Left 903413762 1:23168065-23168087 CCCGGCCCAGCGGTCTGGCTGCG 0: 1
1: 0
2: 1
3: 22
4: 182
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
903413774_903413777 -9 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413777 1:23168117-23168139 GGCGCGGCCGACAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413777 Original CRISPR GGCGCGGCCGACAGCTGCGG CGG Intronic