ID: 903413778

View in Genome Browser
Species Human (GRCh38)
Location 1:23168123-23168145
Sequence GCCGACAGCTGCGGCGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 420}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413768_903413778 9 Left 903413768 1:23168091-23168113 CCAGCAGAGCGCCCGGGACGCGG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 903413778 1:23168123-23168145 GCCGACAGCTGCGGCGGCCGCGG 0: 1
1: 0
2: 3
3: 34
4: 420
903413773_903413778 -2 Left 903413773 1:23168102-23168124 CCCGGGACGCGGGCCGGCGCGGC 0: 1
1: 0
2: 1
3: 31
4: 298
Right 903413778 1:23168123-23168145 GCCGACAGCTGCGGCGGCCGCGG 0: 1
1: 0
2: 3
3: 34
4: 420
903413774_903413778 -3 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413778 1:23168123-23168145 GCCGACAGCTGCGGCGGCCGCGG 0: 1
1: 0
2: 3
3: 34
4: 420
903413765_903413778 29 Left 903413765 1:23168071-23168093 CCAGCGGTCTGGCTGCGAGACCA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 903413778 1:23168123-23168145 GCCGACAGCTGCGGCGGCCGCGG 0: 1
1: 0
2: 3
3: 34
4: 420
903413764_903413778 30 Left 903413764 1:23168070-23168092 CCCAGCGGTCTGGCTGCGAGACC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 903413778 1:23168123-23168145 GCCGACAGCTGCGGCGGCCGCGG 0: 1
1: 0
2: 3
3: 34
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413778 Original CRISPR GCCGACAGCTGCGGCGGCCG CGG Intronic