ID: 903413780

View in Genome Browser
Species Human (GRCh38)
Location 1:23168124-23168146
Sequence CCGACAGCTGCGGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413768_903413780 10 Left 903413768 1:23168091-23168113 CCAGCAGAGCGCCCGGGACGCGG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 903413780 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 17
4: 230
903413774_903413780 -2 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413780 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 17
4: 230
903413773_903413780 -1 Left 903413773 1:23168102-23168124 CCCGGGACGCGGGCCGGCGCGGC 0: 1
1: 0
2: 1
3: 31
4: 298
Right 903413780 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 17
4: 230
903413765_903413780 30 Left 903413765 1:23168071-23168093 CCAGCGGTCTGGCTGCGAGACCA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 903413780 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413780 Original CRISPR CCGACAGCTGCGGCGGCCGC GGG Intronic