ID: 903413782

View in Genome Browser
Species Human (GRCh38)
Location 1:23168140-23168162
Sequence CCGCGGGACCCCTCCCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413773_903413782 15 Left 903413773 1:23168102-23168124 CCCGGGACGCGGGCCGGCGCGGC 0: 1
1: 0
2: 1
3: 31
4: 298
Right 903413782 1:23168140-23168162 CCGCGGGACCCCTCCCCGCCCGG 0: 1
1: 0
2: 6
3: 23
4: 254
903413774_903413782 14 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413782 1:23168140-23168162 CCGCGGGACCCCTCCCCGCCCGG 0: 1
1: 0
2: 6
3: 23
4: 254
903413768_903413782 26 Left 903413768 1:23168091-23168113 CCAGCAGAGCGCCCGGGACGCGG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 903413782 1:23168140-23168162 CCGCGGGACCCCTCCCCGCCCGG 0: 1
1: 0
2: 6
3: 23
4: 254
903413779_903413782 -7 Left 903413779 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 2
3: 20
4: 213
Right 903413782 1:23168140-23168162 CCGCGGGACCCCTCCCCGCCCGG 0: 1
1: 0
2: 6
3: 23
4: 254
903413776_903413782 2 Left 903413776 1:23168115-23168137 CCGGCGCGGCCGACAGCTGCGGC 0: 1
1: 0
2: 2
3: 11
4: 150
Right 903413782 1:23168140-23168162 CCGCGGGACCCCTCCCCGCCCGG 0: 1
1: 0
2: 6
3: 23
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413782 Original CRISPR CCGCGGGACCCCTCCCCGCC CGG Intronic