ID: 903413783

View in Genome Browser
Species Human (GRCh38)
Location 1:23168147-23168169
Sequence ACCCCTCCCCGCCCGGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 508}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413774_903413783 21 Left 903413774 1:23168103-23168125 CCGGGACGCGGGCCGGCGCGGCC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 903413783 1:23168147-23168169 ACCCCTCCCCGCCCGGCCCGCGG 0: 1
1: 0
2: 6
3: 71
4: 508
903413773_903413783 22 Left 903413773 1:23168102-23168124 CCCGGGACGCGGGCCGGCGCGGC 0: 1
1: 0
2: 1
3: 31
4: 298
Right 903413783 1:23168147-23168169 ACCCCTCCCCGCCCGGCCCGCGG 0: 1
1: 0
2: 6
3: 71
4: 508
903413779_903413783 0 Left 903413779 1:23168124-23168146 CCGACAGCTGCGGCGGCCGCGGG 0: 1
1: 0
2: 2
3: 20
4: 213
Right 903413783 1:23168147-23168169 ACCCCTCCCCGCCCGGCCCGCGG 0: 1
1: 0
2: 6
3: 71
4: 508
903413776_903413783 9 Left 903413776 1:23168115-23168137 CCGGCGCGGCCGACAGCTGCGGC 0: 1
1: 0
2: 2
3: 11
4: 150
Right 903413783 1:23168147-23168169 ACCCCTCCCCGCCCGGCCCGCGG 0: 1
1: 0
2: 6
3: 71
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413783 Original CRISPR ACCCCTCCCCGCCCGGCCCG CGG Intronic