ID: 903413812

View in Genome Browser
Species Human (GRCh38)
Location 1:23168227-23168249
Sequence CTGCAGCAGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1361
Summary {0: 1, 1: 1, 2: 22, 3: 171, 4: 1166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903413812_903413825 26 Left 903413812 1:23168227-23168249 CCCTCCTCCTCCTGCTGCTGCAG 0: 1
1: 1
2: 22
3: 171
4: 1166
Right 903413825 1:23168276-23168298 TTCCTTCCTCCGGTGCCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 113
903413812_903413826 27 Left 903413812 1:23168227-23168249 CCCTCCTCCTCCTGCTGCTGCAG 0: 1
1: 1
2: 22
3: 171
4: 1166
Right 903413826 1:23168277-23168299 TCCTTCCTCCGGTGCCCGCCGGG 0: 1
1: 0
2: 2
3: 11
4: 148
903413812_903413824 16 Left 903413812 1:23168227-23168249 CCCTCCTCCTCCTGCTGCTGCAG 0: 1
1: 1
2: 22
3: 171
4: 1166
Right 903413824 1:23168266-23168288 GTCTGATCACTTCCTTCCTCCGG 0: 1
1: 0
2: 2
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903413812 Original CRISPR CTGCAGCAGCAGGAGGAGGA GGG (reversed) Intronic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900270935 1:1788307-1788329 CTGCAGGAGGTGGAGGAGGGTGG - Intronic
900359159 1:2279564-2279586 CTCCAGCTGCAGGGGGAGGGGGG + Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
900510584 1:3058393-3058415 CTGCTGCAGAAGGACGGGGAGGG - Intergenic
900622853 1:3595349-3595371 ATGCAGCAGCCCGACGAGGAGGG - Exonic
900671745 1:3858683-3858705 GAGAAGCAACAGGAGGAGGAAGG - Intronic
900760888 1:4469399-4469421 AGTCAGCAGCGGGAGGAGGAGGG + Intergenic
900858261 1:5203706-5203728 TGGCAGGAGCAGGAGGAAGAGGG + Intergenic
900949753 1:5851832-5851854 TGGCTGCAGCAGGAGGAAGAGGG - Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901229666 1:7634683-7634705 CTGGGGCTGCCGGAGGAGGAAGG + Intronic
901236446 1:7669964-7669986 CTGCAGAAAGTGGAGGAGGAGGG - Intronic
901604728 1:10450234-10450256 CAGCAGCAGCAGGAGGCCGGGGG - Exonic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901908637 1:12436408-12436430 GTGCAGCAGCAGGACTAGGGAGG + Intronic
902377334 1:16036052-16036074 CGGCAGTGGCAGGAGCAGGAAGG - Intergenic
902410062 1:16207138-16207160 CGGCAGCAGCGCGAGGAGGAGGG - Exonic
902412283 1:16218424-16218446 CTGCAGCACTGGGAGAAGGAAGG - Intergenic
902466124 1:16619876-16619898 CTGCAGCAGGAGCATGACGAGGG - Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902983980 1:20144258-20144280 CTGCAGCAGTGGGAGGAGTCAGG - Intronic
903059701 1:20661347-20661369 CTTCGGCAGGAGGAGGAAGATGG - Exonic
903320693 1:22541506-22541528 GGGCAGAAGCTGGAGGAGGAGGG - Intergenic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903570107 1:24297931-24297953 AAGCAGGAGGAGGAGGAGGAGGG + Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903747526 1:25598137-25598159 CTGTAGCAGCAAGAAGAGGCAGG + Intergenic
903768489 1:25749595-25749617 CAGCGGCAGCAAGAGGAGAATGG + Intronic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
903907403 1:26696488-26696510 CAGCAGCAGCGGGAGGAGGCGGG + Exonic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904261711 1:29291389-29291411 CTGCAGGAGAAGGAGGAGTCTGG + Intronic
904263773 1:29306153-29306175 CAGCAGCAGCAGGACTTGGATGG + Intronic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904351192 1:29907881-29907903 CTTCAGCAGAAAGAGGAGGTTGG + Intergenic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904464779 1:30701322-30701344 CTCCATCTTCAGGAGGAGGAAGG - Intergenic
904482074 1:30800414-30800436 CTGGAGCAGAGTGAGGAGGAAGG + Intergenic
904642018 1:31938178-31938200 CCGCAGCAGCAGCAGCAAGACGG - Exonic
904652353 1:32014661-32014683 CGGCAGCCGCAAGAGGAGGGAGG - Intronic
904660938 1:32084294-32084316 AGACTGCAGCAGGAGGAGGAAGG - Intronic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
905172090 1:36115367-36115389 CGGCAGCAGCGGCAGCAGGAGGG + Intronic
905417692 1:37815603-37815625 CTGCAGGGGCAGGAGCATGAGGG + Intronic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
905872698 1:41414314-41414336 CTGCAGCCCCAGGAGCAGGAGGG + Intergenic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906114801 1:43349311-43349333 CAGCAGCAGCAGGCCCAGGACGG - Exonic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906150580 1:43585207-43585229 CTGCAGCAGTGGGTGGAGGATGG + Intronic
906223790 1:44104376-44104398 CTGCAGCAGCAGCAGACGGCTGG - Intergenic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
907178880 1:52552992-52553014 CGGCGGCAGCAGGAGGCGGAGGG - Intronic
907261263 1:53220447-53220469 CTGAAGGAGCAGGAGGCAGAAGG - Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907484657 1:54768860-54768882 AGGCAGCAGCAGTAGGATGAGGG - Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907857812 1:58321247-58321269 CTGCTGCAGCATAAAGAGGAAGG - Intronic
907931040 1:59000469-59000491 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
907971641 1:59388503-59388525 AGGCAGCAGCAGGAGAAGAAGGG + Intronic
908392595 1:63697146-63697168 ATGCAGCAGAAGGAAGATGAAGG + Intergenic
908534646 1:65066744-65066766 GTGCCGGAGGAGGAGGAGGAGGG - Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
910746472 1:90580319-90580341 CTGCAGCAGCTGCAGGGGGAGGG - Intergenic
912045723 1:105453043-105453065 CTCCTACAGCAAGAGGAGGAGGG + Intergenic
912431986 1:109632842-109632864 CTGGAGCAGGAGGGGGAGGCTGG + Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912724063 1:112043383-112043405 CTGCAGGAGGTGGAGGAAGAGGG + Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913093072 1:115492939-115492961 CTGCAGCAGCCACAGGAGCACGG + Intergenic
913215646 1:116617889-116617911 CTGCAGCTGTGGGAGGAGGTGGG - Intronic
913715295 1:121527815-121527837 ATGCAGCAGAAGGAGGAAAAAGG - Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
914957837 1:152180614-152180636 CTGCAGGAGCAGGACAAGGTGGG - Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915164473 1:153941021-153941043 CTGCAGCAGCTGCAGGAAGCTGG + Exonic
915471580 1:156128952-156128974 AAGCAGCTGCAGGGGGAGGAGGG - Intronic
916143781 1:161722639-161722661 CTGCAGCAGCTGCAGAAGGATGG - Exonic
916217703 1:162411643-162411665 CTGCAGCAGCAGGAGGGACATGG - Intronic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917202332 1:172531312-172531334 CTCCAACTGCAGGAGAAGGAAGG + Intergenic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919638814 1:200029793-200029815 CTGCAATACCAGGAGGCGGAGGG - Intronic
919738168 1:200966486-200966508 CTGCAGAAGCAGGAGGTTGGGGG - Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
919921224 1:202167736-202167758 CTACAGCATCAGGAAGAGGTGGG + Intergenic
919921390 1:202168494-202168516 CTACAGCATCAGGAAGAGGTGGG + Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
919989862 1:202702262-202702284 CTGCTGCAGCTGCAGGAGGCAGG - Intronic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920199469 1:204250638-204250660 CTGCAGCAGGGGCAGGATGAGGG + Intronic
920255402 1:204651069-204651091 CTCCAGCAGCAGGCAGAAGAGGG + Intronic
920641919 1:207760785-207760807 TGGCAGGAGCAGGAGGAGCAAGG + Intronic
920825853 1:209423790-209423812 CTTCAGCAGGGGGAGGAGAAAGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921060249 1:211578958-211578980 CAGCCGGAGCAGGAGCAGGAGGG + Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921380907 1:214523742-214523764 CAGCCACCGCAGGAGGAGGAGGG - Intronic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921921613 1:220676331-220676353 CTCAAGCAGCAAGAGGAGGTGGG - Intergenic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922251866 1:223856582-223856604 CTGGGGCAGCTGGAGGAGCACGG + Intergenic
922614168 1:226951351-226951373 CTGAAGCGACAGGAGGAGGGAGG + Intronic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923006900 1:230057500-230057522 CTGCAGCTGAAGGTGGGGGACGG + Intergenic
923146787 1:231203873-231203895 CTCCAGCTGCAGTAGGGGGACGG - Exonic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
924162262 1:241245348-241245370 CGGCAGGAGCAAGAGGAGGGGGG - Intronic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
924880177 1:248152470-248152492 TTACAGCAGCAGGAGCAGCAAGG - Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063481150 10:6377835-6377857 CTCCAGGAGAAGGTGGAGGATGG + Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1064988163 10:21231755-21231777 AGGCATCAGCAGGAGGAGGTAGG + Intergenic
1065140381 10:22714102-22714124 CAGCTGCAGCCGGAGGAGGAGGG + Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1067145629 10:43691745-43691767 CAGCTGCTGAAGGAGGAGGAGGG + Intergenic
1067206590 10:44221068-44221090 CTGCACCAGCAGGGGTGGGAAGG - Intergenic
1067224153 10:44364496-44364518 GAGCAGCAGCAAGAGGAGGCCGG + Intergenic
1067284084 10:44894816-44894838 CTGCAGCAGCAAGAGAGGGCAGG + Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067427028 10:46218210-46218232 CTGCAGCAGCCAGAGGTTGAAGG - Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1067769136 10:49110939-49110961 CTTCAGCACCAGGAGGTGGGTGG + Intronic
1067828571 10:49597028-49597050 CCACAGCAGCAGGAGCAGGAGGG - Intergenic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1069777182 10:70933999-70934021 CTCTAGGAGCAGGAGGAAGAAGG + Intergenic
1069914829 10:71781008-71781030 CTGCAGCAGGAGGTTGTGGAGGG + Intronic
1070115588 10:73525810-73525832 CTGCAGCAGCAGTAGTAAAAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1070803407 10:79256430-79256452 CTGCAGCTGCAGGAGGGAGGGGG - Intronic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1071813300 10:89206915-89206937 GTGCAGCAGCAGGAGCAGCTCGG + Exonic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072195728 10:93116018-93116040 AGGCAGGAGGAGGAGGAGGAGGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072453994 10:95560831-95560853 CTGCAGCAGCCAGAGGAAGGCGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072982922 10:100114914-100114936 CTGCAGAAGCTAGAGGAGGGGGG - Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073143170 10:101262231-101262253 CTGAAGCATCAGGAGGGAGAGGG - Intergenic
1073299489 10:102462114-102462136 TTCCAGCCGGAGGAGGAGGATGG + Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1073540944 10:104315825-104315847 CTGGAGCAGGTGGCGGAGGAGGG - Exonic
1074210001 10:111322524-111322546 TGGCAGCAGCAGTAGGAGGATGG + Intergenic
1074297023 10:112199383-112199405 CAGCAGCTGCAGGAGGAGATGGG + Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074509661 10:114100902-114100924 CCGGAGCAGAAGGAGGAGGCGGG + Intergenic
1074627996 10:115215059-115215081 CTCTAGCAGCAGGAACAGGAAGG - Intronic
1075035250 10:119060746-119060768 CTGCTGCAGAAGGCGGAGGATGG + Exonic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075529873 10:123220004-123220026 CAGCAGGGGCAGGAGGAGAATGG - Intergenic
1075634480 10:124021001-124021023 CTCCCTCAGCAGGAGGATGAGGG - Intronic
1075685809 10:124364507-124364529 CTGCTGCTGCAGGAGGTAGATGG - Intergenic
1076246132 10:128949106-128949128 CTTCAGCAGGAGGACCAGGAGGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076488196 10:130837711-130837733 CACCAGCAGCTGGAGGAGGCAGG + Intergenic
1076569057 10:131420423-131420445 CCTCAGCAGGAGGAAGAGGAGGG - Intergenic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076732450 10:132445514-132445536 CTCCAGCGGCAGGAGGCTGAGGG + Intronic
1076768917 10:132652355-132652377 CTGCAGCCCCAGGAGGAGCGGGG + Intronic
1076812790 10:132897994-132898016 CTCCAGTGGGAGGAGGAGGACGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076931503 10:133534687-133534709 CAGCAGCTTCAGGAGGAGGGCGG - Intronic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077063350 11:627114-627136 CAGCAGCAGCAGGAGGGGCCGGG + Exonic
1077104756 11:837340-837362 CAGCTGCAGCAGGAGGTGGGTGG + Exonic
1077164624 11:1129508-1129530 CTGCAGCAGCTGGACGGGGTCGG - Intergenic
1077262697 11:1631263-1631285 CTTCAGCGGAAGGATGAGGAAGG + Intergenic
1077343168 11:2035040-2035062 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1077357339 11:2124535-2124557 CTGCAGCAGGAAGAGGTGGAGGG - Intergenic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077483268 11:2826522-2826544 AAGCAGCAGCAGGAGGGGGCGGG - Intronic
1077581282 11:3418826-3418848 CTGCTGCAGCAGGAGGGGGGCGG + Intergenic
1077847301 11:6039527-6039549 CTACAGAACCAGGAGAAGGAAGG - Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077907627 11:6546386-6546408 CCGCAGCAGCAGGTGCAGGTTGG - Exonic
1077919300 11:6631053-6631075 CTGCACCAGCAGCTGGAGGCTGG + Exonic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078118431 11:8480245-8480267 CTGGAGCATCAGGTGGAAGAAGG + Intronic
1079237798 11:18702069-18702091 CTGCAGGAGCTGGATCAGGATGG + Exonic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079834072 11:25309045-25309067 GAGCAGGAGCAAGAGGAGGAAGG - Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1080798858 11:35590637-35590659 CTATAGCATCAGGAGGAGGGAGG - Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081634581 11:44712296-44712318 CTGCAGCAGCAGTGGCAGGTTGG + Intergenic
1081694121 11:45097836-45097858 CTGCAGTGGCAGGAGGAAGTGGG + Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081806688 11:45894740-45894762 CTCCAGGAGCAAGGGGAGGAAGG + Intronic
1081810988 11:45914024-45914046 GGGCAGCAACAGGAGGAGCAGGG + Intronic
1081831782 11:46120995-46121017 AAGCAGGAGGAGGAGGAGGAGGG + Exonic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1082928935 11:58579312-58579334 CCGGAGCAGCAGGACCAGGAAGG + Exonic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1083085916 11:60145263-60145285 CTGCACCATCAGGAAGTGGATGG + Intergenic
1083164179 11:60873477-60873499 GTGCAGCAGCAGGACCAGGTTGG - Exonic
1083293123 11:61700725-61700747 CCACAGCAGCAAGAGAAGGAAGG - Intronic
1083430447 11:62611478-62611500 CTGCAGCCGCAGCAGGCGAAGGG + Exonic
1083439351 11:62665665-62665687 CTGCAGCGGGAAGTGGAGGAGGG - Exonic
1083539463 11:63502408-63502430 AGGCAGCTGCAGGAAGAGGATGG - Intergenic
1083674320 11:64317058-64317080 CTCCAGCAGCAGGTGGTGCATGG + Exonic
1083679466 11:64344513-64344535 GTGCAGCTGGAGGAGCAGGAGGG + Exonic
1083780095 11:64913308-64913330 CTGCAGCAGCTTGTGCAGGAAGG + Exonic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1083884006 11:65562166-65562188 CTCCGGCACCAGGAGGAGGAGGG - Intergenic
1083900786 11:65642303-65642325 CTGCGGCGGGAGGAGAAGGAGGG + Exonic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084178702 11:67436228-67436250 CAGCAGCAGCAGCAGGACAACGG + Exonic
1084185083 11:67467316-67467338 CCCCAGCAGCAGGAGCAGGAAGG + Exonic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084652034 11:70495140-70495162 CTGCTGCAGCCGGAGGAGCTGGG - Intronic
1084687294 11:70704025-70704047 CCCCAGCAGCAGGAGTAGGGCGG - Intronic
1084693824 11:70742228-70742250 TGCCAGCAGAAGGAGGAGGAAGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1084860436 11:72014504-72014526 GGGCAGCAGCAGGAGGAGCGTGG - Exonic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1085024791 11:73230127-73230149 CAGAAGCTGCAGGAGGAGCAAGG - Intronic
1085119404 11:73957555-73957577 CTGCGGCACCTGGAGGAGGGAGG - Intronic
1085242638 11:75071436-75071458 CACCAGCAGAAGGGGGAGGAAGG + Intergenic
1085266404 11:75240512-75240534 GTGCTGGAGAAGGAGGAGGAAGG + Intergenic
1085699033 11:78729820-78729842 AAGCAGGAGGAGGAGGAGGAAGG + Intronic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087182602 11:95154646-95154668 CTGCAGGAGCATTTGGAGGAGGG - Intergenic
1087234962 11:95707812-95707834 CTGCAACAGCGGGAGGTGGCAGG - Intergenic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1087811710 11:102615671-102615693 CTGCAGCAGAGGGTGCAGGAAGG - Intronic
1087954856 11:104273268-104273290 CTGTAGCAGCATGAGCAGCAGGG + Intergenic
1088619993 11:111671986-111672008 CTGCAGCAGCAGAAGATGGCTGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089096388 11:115923283-115923305 AGACAGCAGCAGGAGTAGGAGGG + Intergenic
1089100702 11:115959754-115959776 CAGCACCAGCTGGAGGAGGGGGG - Intergenic
1089453895 11:118614656-118614678 CTCCAGCGGCAGGAGGGTGATGG - Exonic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089968061 11:122670297-122670319 TGGCAGCAGCAGGTGGAGGCTGG - Intronic
1090099455 11:123778764-123778786 CTGCAGCTGCAGGAGAAGCTGGG - Intergenic
1090402847 11:126460103-126460125 CGGGAGCAGGAGGAGGGGGAAGG + Intronic
1090840075 11:130479657-130479679 CTACAGCAGCAGCAGTGGGAAGG - Intergenic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1202826154 11_KI270721v1_random:90229-90251 GTGCTTCAGCTGGAGGAGGAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1092197085 12:6555977-6555999 CTCCTGCAGCAGGAGCAGCAGGG - Exonic
1092197090 12:6555988-6556010 CTGCTGCAGGAGGAAGAGGTTGG + Exonic
1092231804 12:6779934-6779956 CTGCTGGAGCAGGAGGGGCATGG + Intergenic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1093661170 12:21758608-21758630 CAGGAGCAGCAGGAGAAGTATGG - Intergenic
1093795682 12:23307775-23307797 GTCCATCACCAGGAGGAGGATGG - Intergenic
1094375986 12:29787692-29787714 CTGCAGCCCCAGGAGGAAAAAGG + Intergenic
1094474878 12:30833334-30833356 CTTCAGCTGGAGGTGGAGGATGG - Intergenic
1094512713 12:31105863-31105885 CCGCAGCAGCTGGGGGAGGTTGG + Intergenic
1096005643 12:48168850-48168872 CTGGAGCAGCCGGAGGAGCACGG + Intronic
1096143890 12:49264861-49264883 CAGGAGCAGGAAGAGGAGGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096497642 12:52047636-52047658 CTGCAGCAGCTTGGGGAGGTGGG + Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096673655 12:53214859-53214881 CTGCAGGAGCTGGGGGAGGGGGG + Intronic
1096683122 12:53270062-53270084 CTGCAGCAGCTGCGGGATGATGG + Exonic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097544246 12:60978940-60978962 CTGCGGAAGCTCGAGGAGGATGG - Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1097827005 12:64184492-64184514 GGGCAGCAGTAGCAGGAGGAAGG - Intergenic
1097861608 12:64523634-64523656 CTCCAGTTACAGGAGGAGGAAGG - Intergenic
1098187648 12:67914892-67914914 TTACAGCAGAAGGATGAGGAAGG + Intergenic
1098205958 12:68109896-68109918 CAGCAGCTGCATGAGCAGGAAGG - Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099362980 12:81729734-81729756 CTGCAGCAGAAGGAAAAGTAAGG + Intronic
1100689631 12:97025958-97025980 CGGCAGGGGCAGCAGGAGGAAGG - Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101679287 12:106949192-106949214 CTTCTGCAGCAGGGAGAGGAGGG - Intergenic
1101680015 12:106955803-106955825 CTGGAGCCGCGGGAGGAGGCGGG + Exonic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102131164 12:110529859-110529881 CTGCCGTAGCAGGAGGGGAAGGG + Intronic
1102346363 12:112163614-112163636 CAGCAGCTGCAGGGGGATGATGG + Exonic
1102441382 12:112966404-112966426 CTGCAGCAGGTGGAGGAGGTGGG - Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103228635 12:119309224-119309246 CAGCAGCAGCTGGAGGCAGAAGG + Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103610410 12:122120724-122120746 CTTCAGGAGCAGGGGAAGGAGGG + Intronic
1103721154 12:122976279-122976301 CTCCAGGGGAAGGAGGAGGAGGG - Exonic
1103730837 12:123026773-123026795 CAGCAGCAGCTGGAAGAGGCAGG - Intronic
1103936494 12:124480208-124480230 CTCCCGCTGCAGGAGGAGGATGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104732657 12:131116570-131116592 CTCCAGAGGAAGGAGGAGGAGGG - Intronic
1104749588 12:131229861-131229883 CTGCTCCATCAGGAGGAGGCGGG + Intergenic
1104757358 12:131277474-131277496 CTGCAGGAGGAGGAGGAGTTGGG + Intergenic
1104775688 12:131389000-131389022 CTGCAGGAGGAGGAGGAGTTGGG - Intergenic
1104783846 12:131437456-131437478 CTGCTCCATCAGGAGGAGGAGGG - Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1105578911 13:21675576-21675598 CTGCTGCCGGAGGAGGAGGAGGG - Intronic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106156073 13:27157779-27157801 CTGCATCAGTTGGAGAAGGAAGG - Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107022799 13:35768330-35768352 CTGCAGCAGCAGCCTGTGGATGG + Intergenic
1107588509 13:41879305-41879327 CAGCAGCAGAAAGAGGAGGAGGG - Intronic
1108200899 13:48042005-48042027 GGGCAGCTGCATGAGGAGGACGG + Intronic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108642256 13:52394101-52394123 CAGCAGCAGCAGGAAGACGCTGG - Intronic
1108729770 13:53222738-53222760 GACCAGTAGCAGGAGGAGGATGG + Intergenic
1109316496 13:60755499-60755521 CTGCACCAGCAGGTGGAGTCTGG + Intergenic
1109907608 13:68865499-68865521 CTGCAGCAGTGGGTGGAGGTGGG - Intergenic
1110098260 13:71559956-71559978 CTGCACCAGCAAGAGAGGGAAGG + Intronic
1110738883 13:78970924-78970946 CTGCAGCAAGAGGAAGGGGATGG - Intergenic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1113274974 13:108718525-108718547 ATGCAGCAGCAGGAAGCAGAAGG + Intronic
1113400908 13:109992565-109992587 CTGGAGCAGCCTGAGGAGGGGGG - Intergenic
1113692789 13:112323635-112323657 CTGCAGGGGCAGGAAGCGGAGGG - Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114183226 14:20382306-20382328 CTGCAGCAGCAGGGGGACAGTGG + Exonic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114516360 14:23302358-23302380 CTGCACCAGCCGGAGGCGGCGGG - Exonic
1114618811 14:24082595-24082617 CTGCAGCAGCAGCTGGGGGCTGG - Exonic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114992275 14:28301298-28301320 CGGCACCAGCAGGAGGTGGAAGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115203333 14:30875404-30875426 CGGCAGCAGGAGGTCGAGGAAGG + Intronic
1115754681 14:36519362-36519384 CGGCGGCGGCTGGAGGAGGAAGG + Exonic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118166857 14:63345194-63345216 CTGCAGCAGCAACTGGAGCAAGG + Intergenic
1118186561 14:63543191-63543213 CTGCAGCGGCAGCAAGAGAAGGG + Exonic
1118373372 14:65156645-65156667 CTGCTGGAGCGGGAGGAGGCAGG - Intergenic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119756850 14:77125593-77125615 CACCAGCAGCAGGAGAAGGACGG - Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121020253 14:90575573-90575595 CTGCAGCACCAGTGGGAGGGGGG + Intronic
1121111731 14:91317460-91317482 CTTCAGCACCAGCAGGAGGCAGG - Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121586652 14:95067574-95067596 TTCCAGCAGCATGAGGGGGAGGG + Intergenic
1121610041 14:95272303-95272325 CTCCAGGAAGAGGAGGAGGAGGG + Intronic
1121793926 14:96720240-96720262 CTGCACCAGCAGGAATGGGAGGG + Intergenic
1122068108 14:99187776-99187798 CTCCAGGAGGAGGAGGAGGAAGG - Intronic
1122113994 14:99518646-99518668 CTGCAGCGGAAGGTGCAGGAAGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1122886934 14:104714343-104714365 CTGGAGCAGTTGGAGGAGGGTGG + Exonic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1122981917 14:105195927-105195949 CTGAACCAGCTGGAGCAGGATGG - Intergenic
1123016145 14:105376667-105376689 CTGCAGGAGCAATAGGAGGCGGG - Intronic
1123468552 15:20533733-20533755 CTGCAGCAGCAGGAAGCTCAGGG - Intronic
1123649562 15:22467329-22467351 CTGCAGCAGCAGGAAGCTCAGGG + Intronic
1123728870 15:23128944-23128966 CTGCAGCAGCAGGAAGCTCAGGG - Intronic
1123747034 15:23326409-23326431 CTGCAGCAGCAGGAAGCTCAGGG - Intergenic
1123787356 15:23686988-23687010 CTGCAGCAGGCTGCGGAGGAGGG - Exonic
1123821819 15:24037874-24037896 GTGCAGCAGCAAGAAGAGAAAGG + Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124120372 15:26883514-26883536 CTGCTGCGGCTGGAGGACGACGG + Exonic
1124142046 15:27086224-27086246 CCCTAGGAGCAGGAGGAGGAAGG + Intronic
1124279303 15:28349725-28349747 CTGCAGCAGCAGGAAGCTCAGGG - Intergenic
1124303395 15:28561883-28561905 CTGCAGCAGCAGGAAGCTCAGGG + Intergenic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124532295 15:30518325-30518347 CTGCAGCAGCAGGAAGCTCAGGG + Intergenic
1124593787 15:31077347-31077369 CTGGAGCAGAAGGAGGTGGGAGG + Intronic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124723244 15:32131973-32131995 CTGAAACAGCAGGAGGCGGCTGG + Intronic
1124766358 15:32489320-32489342 CTGCAGCAGCAGGAAGCTCAGGG - Intergenic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1124955022 15:34354640-34354662 GGGCAGCAGCAGGAGGAGGAAGG + Exonic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125611385 15:40973486-40973508 GTCCAGCGGCAGGAGAAGGAGGG - Intergenic
1125679216 15:41520475-41520497 CTGCAGGGGCAGGAGGACCAGGG + Exonic
1125726302 15:41870015-41870037 CTGCAGCTGCGGGAGGGGCAGGG + Exonic
1125728868 15:41881970-41881992 CTGCGGCGGCTGGAGGAGCAGGG - Exonic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126104233 15:45136814-45136836 CTACACCAGCAGCAGGAGAATGG - Intronic
1126269052 15:46791313-46791335 CTGCAGCAGCAGGAAAATGACGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126804398 15:52331742-52331764 CTGCTGCAGCATGAGGTGGACGG - Intronic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1127279614 15:57477858-57477880 GTTCAGCAGCAGGAGGGGCATGG - Intronic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1127997636 15:64162903-64162925 CGGCAGCAGCAGGAAGAAGACGG + Exonic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128134193 15:65250631-65250653 CTGCAGCAGTAGGAGAAGGGAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129011357 15:72420771-72420793 CTGAAGCAGAATGAGGAAGAGGG - Intergenic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1129665308 15:77576313-77576335 ATGCTGGAGGAGGAGGAGGAGGG + Intergenic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1130549111 15:84878524-84878546 CTGAAGCAGAAGGAGGTGGTTGG - Intergenic
1131188281 15:90293679-90293701 CTGCAGCAGCAGGAAGCTCAGGG + Intronic
1131282545 15:91033117-91033139 CTGCAGCAGCAGGAAGCTCAGGG - Intergenic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132747327 16:1442488-1442510 TTGCTGCAGCAGGAGGAGCAGGG - Exonic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1132807088 16:1779856-1779878 CTGCAGGAGCTGGAGGCGGGCGG + Intronic
1132999455 16:2841690-2841712 CCACAGCAGCAGAAGCAGGATGG + Intergenic
1133102215 16:3486391-3486413 CTGCCCCAGCCTGAGGAGGAGGG + Exonic
1133118170 16:3589979-3590001 GTGCTGCAGCAGGAGGATGAGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133768595 16:8854784-8854806 CTCCAGCTCCAGGAGGAAGAGGG + Exonic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134222005 16:12362394-12362416 CTGCAGCAGGTGGAGGAGGCTGG - Intronic
1135125501 16:19806166-19806188 CTGCAGGAGCAGGAGGGTGCTGG + Intronic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136028389 16:27484958-27484980 CTGGTGCAGCTGGAGGAGGCAGG - Intronic
1136367220 16:29814345-29814367 CTGCAGCAGGGGGACGTGGACGG + Exonic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136957739 16:34804237-34804259 CTGCATCAGCAAGTGCAGGAGGG - Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137504109 16:49036054-49036076 CTGCAGCAGGAAGACAAGGAAGG + Intergenic
1137587251 16:49671055-49671077 CTGCAGCTGCATGTGAAGGAAGG - Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137673936 16:50294569-50294591 CAGCAGCAGCAGGAGCACGCAGG - Intronic
1137686637 16:50391247-50391269 CTGCAGCAGGGAGAGGAGGTGGG + Intergenic
1137966119 16:52935612-52935634 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138514072 16:57526304-57526326 CTGCAGCTCCAGGAGGTGAAAGG - Intronic
1138582842 16:57952876-57952898 CTGCAGCACTGAGAGGAGGACGG + Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139643920 16:68313535-68313557 CTGAGGCAGGAGGAGAAGGAGGG - Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140247382 16:73263648-73263670 CTGCTGCTGCAGAAGGACGATGG - Intergenic
1140457208 16:75112438-75112460 CAGCTGCTGCAGGAGGAGGTGGG - Exonic
1140672115 16:77289412-77289434 CTGCAGCAGAGAGAAGAGGAAGG + Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141535576 16:84677564-84677586 ATGCAGCAGCAGGAGGCAGCAGG + Intergenic
1141775761 16:86121756-86121778 AGGCAGGAGGAGGAGGAGGAGGG - Intergenic
1141992459 16:87618328-87618350 GGGCAGCAGCTGGGGGAGGAGGG + Intronic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142569802 17:866035-866057 CTACAGCAAAAGGAGAAGGAAGG + Intronic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1142748460 17:1972950-1972972 CTGGAGCAGCAGGTGGGGGTCGG - Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143323106 17:6080744-6080766 CTGCAGCAGCAGCAGGCTGCCGG - Exonic
1143365049 17:6401964-6401986 TGGCTGGAGCAGGAGGAGGAGGG + Intronic
1143462914 17:7115231-7115253 AAGCTTCAGCAGGAGGAGGAAGG + Intronic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143956646 17:10675243-10675265 CAGCAACAGCAGGAGGCAGATGG - Exonic
1144765782 17:17731697-17731719 CAGCAGCTCCAGGAGGAGGGAGG - Intronic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145089918 17:19977888-19977910 CTGCACCCGCGGGAGGGGGATGG - Intronic
1145103879 17:20098740-20098762 AGGCAGCAGGAGGAGGAGGATGG - Intronic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146635487 17:34501310-34501332 CCCCTGCAGCAGCAGGAGGAAGG + Intergenic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1146919581 17:36701561-36701583 ATGCAGTTGAAGGAGGAGGAAGG - Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147261139 17:39210340-39210362 CTCCAGCAGCCCGAGGAGGGTGG - Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147689783 17:42308124-42308146 CACCAGCAGCAGGAGGACCAAGG - Intronic
1147904598 17:43814481-43814503 TTCCAGTAGCAGGAGGAGGTTGG - Intronic
1148021689 17:44557705-44557727 CGGCAGCAGCAGGCGGGGCAGGG - Exonic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148436943 17:47692733-47692755 ACCCAGCAGGAGGAGGAGGAAGG + Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148670281 17:49404995-49405017 CTGGGGCAGCTGGAGGAGCACGG + Exonic
1148686533 17:49504046-49504068 ATGCAGCTGGAGGTGGAGGAGGG - Intronic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1148713726 17:49700518-49700540 CTTCAGCAGCTGGAGGAGGCAGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150166710 17:62950939-62950961 CTCCAGCAGCAGGAGGTGCATGG + Intergenic
1150285157 17:63950116-63950138 CTGGCCCAGCAGGAGGAGGTGGG - Intronic
1150285533 17:63951742-63951764 ATGCAGCAGCCCCAGGAGGAAGG + Exonic
1150621047 17:66807892-66807914 CTGCAGTAGGAGGGAGAGGAAGG + Exonic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151309517 17:73284947-73284969 CAGCTGCAGCAGGAGGGAGACGG - Exonic
1151561434 17:74871993-74872015 CTGGAGCAGCAGGTGAATGATGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151562535 17:74878265-74878287 CAGCAGCAGCAGGAGGGCCAGGG + Exonic
1151699910 17:75737571-75737593 CGGCAGGAGGAGGAGGAGCAGGG - Exonic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1151750930 17:76037156-76037178 CTGCAGCATCGTGAGGGGGACGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152335464 17:79698018-79698040 CTGCAGGAGCAGGTGGGGGTGGG + Intergenic
1152536369 17:80952433-80952455 CTGCAGCAGAAGCTGGCGGAGGG - Intronic
1152558582 17:81066832-81066854 CTCCACCTGCAGGAGGAGGCTGG - Intronic
1152605744 17:81288883-81288905 CTGCACCAGCACGGTGAGGACGG + Intronic
1152642630 17:81455529-81455551 CGCCGACAGCAGGAGGAGGAGGG + Intronic
1152667949 17:81582199-81582221 CTGCAGCAGCACAACCAGGAGGG + Intronic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153448265 18:5197265-5197287 CAGCGGCGGCGGGAGGAGGAGGG + Intronic
1153457256 18:5295364-5295386 CTACAGCCGCCGGCGGAGGAGGG - Intronic
1153646183 18:7198105-7198127 CCGCAGCAGCAGGAGGAAATGGG + Intergenic
1154107443 18:11534562-11534584 CTGAAGCGCCAGCAGGAGGAGGG - Intergenic
1154268854 18:12901946-12901968 CTCCAGCAGCGAGGGGAGGAGGG - Intronic
1154359270 18:13645459-13645481 CTGCAGCAGTAACGGGAGGATGG + Exonic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155171319 18:23268662-23268684 CTGGGGCAGCAGGACTAGGATGG + Intronic
1155399198 18:25419704-25419726 CAGAAGCAGCAGGGGCAGGATGG - Intergenic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1156144477 18:34159302-34159324 CGGCAACGGCCGGAGGAGGAAGG + Intronic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156367203 18:36440291-36440313 CTGCAGCAGAAGCAGGCGCAGGG + Intronic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157165842 18:45357668-45357690 CTGCAGCTTCAGGCAGAGGAGGG + Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157585735 18:48800071-48800093 TTTCAGCAGCCGGAGGAAGAGGG + Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157741534 18:50097593-50097615 CTGCAGCAGCAGCAGAATGTAGG + Intronic
1157793640 18:50556248-50556270 AGGCAGCAGCTGGAGGAGAATGG + Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159120533 18:64163997-64164019 CTACATCAGCAGTAGCAGGAAGG + Intergenic
1159586655 18:70288980-70289002 CTCCTGGAGGAGGAGGAGGAAGG + Exonic
1159740950 18:72169446-72169468 ATACAGGAGCAGGAGGAAGATGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1159960892 18:74555229-74555251 CTCCTGCAGCAGGAGGAAGGAGG - Intronic
1160038082 18:75319778-75319800 CAGCAGCTGCAAGAGGTGGAAGG - Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160406145 18:78647453-78647475 CCGCAGGAGCAGGAGGCGGAGGG + Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1160720333 19:594387-594409 CAGCAGCAGCAGGAGACGGCAGG - Intronic
1160735786 19:661848-661870 GAGCAGCCGCAGGAGGTGGAGGG - Intronic
1160818334 19:1046541-1046563 CTGCTGCAGCGGGAGGAGCAGGG + Intronic
1160842229 19:1151283-1151305 CTGCAGCTGCAGGAAGGGGGCGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161025253 19:2033831-2033853 CTGCAGCTGCAGTGGGAGGGAGG - Intronic
1161042747 19:2118692-2118714 CTGCAGCAGAAGGAGCAGGCCGG - Exonic
1161252157 19:3286004-3286026 CTGCAGCAGCAGCAGCGAGAAGG + Exonic
1161421792 19:4179927-4179949 GGGCTGCAGCAGGAGCAGGAGGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161768309 19:6218617-6218639 CTGCAGGAGGAGGAGGCGGGTGG - Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162387474 19:10368521-10368543 CTGAAGCTGCAGGTGGGGGAGGG - Intronic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1163032609 19:14554195-14554217 CTGCAGCAGCCGGAGGGAGCAGG - Intronic
1163153333 19:15427531-15427553 AGGCTGCAGCAGGAGGAGAAAGG + Exonic
1163160277 19:15460135-15460157 ATGCAGGAGGTGGAGGAGGAGGG + Intronic
1163263160 19:16203525-16203547 CTGATGGAGAAGGAGGAGGAGGG + Exonic
1163377423 19:16942021-16942043 TGGCTGGAGCAGGAGGAGGAGGG - Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163759839 19:19130208-19130230 GGCCAGCAGCAGGAAGAGGAAGG + Exonic
1164156594 19:22601209-22601231 CTGCAGCAGCAGGAAGCTTAGGG + Intergenic
1164412925 19:28020715-28020737 AAGCAGGAGCGGGAGGAGGAGGG + Intergenic
1164609224 19:29621022-29621044 CTGGAGCAGCAGGTGGTGGGAGG - Intergenic
1164769820 19:30799954-30799976 CTCGTGCAGCAGGAGGAGGAGGG - Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165062220 19:33210503-33210525 CAGCAGCAGCAGGCCCAGGATGG + Exonic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1165545141 19:36528808-36528830 CTACAGGATCAGGAGGAGGTTGG + Intergenic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166759519 19:45215891-45215913 CAGCGGCGGCAGGAGAAGGAGGG + Intronic
1167096047 19:47375619-47375641 CGGCTGCAGGAGGAGCAGGACGG + Exonic
1167300331 19:48674084-48674106 GTGCATCAGCTGCAGGAGGATGG + Intergenic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167443669 19:49524959-49524981 CAGAAGCAGCAGGAGACGGAAGG - Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
1167837454 19:52085734-52085756 CTGGAGCAGAGGGAGCAGGAAGG + Intronic
1168048389 19:53810397-53810419 CTCCAGCAGCAGCTGGAGGGTGG - Exonic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
1168393226 19:56027674-56027696 CTGCAGCTGCAGGACGTGGTGGG + Exonic
924987790 2:287794-287816 CAGCAGCAGCCCCAGGAGGAGGG + Exonic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
925880326 2:8346748-8346770 CTGCTTCAGATGGAGGAGGAAGG - Intergenic
925991271 2:9256908-9256930 CTGCAGCAGGAGGATCAGGAAGG - Intronic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926212196 2:10879296-10879318 CAGCAGCTGGAGGAGCAGGAAGG - Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139149 2:20118066-20118088 CAGGAGCAGCTGGAGGAGCAGGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927173115 2:20387015-20387037 CTGCAGCATCATGTGGTGGAAGG - Intergenic
927216609 2:20671017-20671039 CGGCCGCAGACGGAGGAGGACGG + Exonic
927384328 2:22515729-22515751 CAGCAGGAGCTGGAGGAGAAGGG - Intergenic
927513271 2:23657853-23657875 TGGCAGGAGCAGGAGCAGGAAGG + Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927793369 2:26028313-26028335 CTCCAGCAGCAGGTGGTGCATGG + Intergenic
927865327 2:26584227-26584249 CTGCAGCACCAGGAAGTGGAAGG + Intronic
927992445 2:27457739-27457761 CTGCAGGAGCTGGAGGCTGAAGG - Exonic
928090937 2:28374746-28374768 CTGGTGCAGCACGAGGCGGAGGG + Intergenic
928206911 2:29290930-29290952 CTGCAGCAGGAGGTGGTGGTGGG + Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
929000694 2:37344766-37344788 CACCAGCAGCAGCAGGTGGAGGG - Exonic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930468473 2:51783167-51783189 CTGGAGCAGCTGGAGAGGGAGGG - Intergenic
930847770 2:55923812-55923834 CGGCAGGAGGAGGAGGAGAAAGG + Exonic
931258910 2:60599767-60599789 GTGCAGCATCAGGAGGAAGTTGG + Intergenic
931295805 2:60923984-60924006 CTGGAGCTGCATGAGGAGGTGGG - Exonic
931671800 2:64654072-64654094 CGGCCGCAGGAGGAGCAGGAAGG + Intronic
931736999 2:65204986-65205008 CTGCAGCTGCAGCAGCTGGAGGG - Intergenic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
931936006 2:67197190-67197212 CTCCAACAGCAGGTTGAGGATGG - Intergenic
931991785 2:67797475-67797497 CTGATGCAGCAGGAGGGGGTGGG + Intergenic
932453920 2:71834251-71834273 CTGGAGCTGCTGGAGGAGGATGG + Intergenic
932476354 2:72008771-72008793 CGGGAGCACCAGGAGGAGAAGGG + Intergenic
932486004 2:72084765-72084787 CTGCCGCACCAGGAGCAGCAAGG + Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
932777957 2:74539735-74539757 CTGCGGCCCCAGGAGGTGGATGG - Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
934681215 2:96285234-96285256 CTGCAGCAGCATTCGCAGGATGG + Exonic
934926554 2:98385845-98385867 CGGCAGGAGCAGGAGGAAGGTGG + Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935103830 2:100021057-100021079 CTTCAGGATCAGGAGGAAGAGGG - Intronic
935632693 2:105224860-105224882 CAGCAGCACGAGGAGGAGGAGGG - Intergenic
935860008 2:107319400-107319422 TAGCAGCAGCAGGAAGAGAAAGG - Intergenic
936044035 2:109172377-109172399 CTCCAGGAGCAGGGAGAGGACGG - Intronic
936386028 2:112030125-112030147 ATGCAGGAGCAGGAGCAAGAGGG + Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
937027358 2:118710753-118710775 CAGCAGCAGCAGGGGGTGGCAGG - Intergenic
937372480 2:121309890-121309912 CTGCAGCAGGAAGTGGAAGAGGG - Intergenic
937379637 2:121365112-121365134 CTCCAGCAGCAGGAGCAGAATGG + Exonic
937972780 2:127563585-127563607 TTGCTGCAGCAGTAGGAGCAAGG - Intronic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938408518 2:131045812-131045834 CTGCAGCAGCCTGAAGAGGGGGG - Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939219867 2:139287931-139287953 CTGCAGCAGAAGGTGGAGCCTGG + Intergenic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939668195 2:144976792-144976814 CAGCAGCAGTGGGAGGGGGAAGG - Intergenic
940485022 2:154287400-154287422 CTGGGGCAGCTGGAGGAGCATGG - Intronic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
940885286 2:158984661-158984683 GTGCAGGAGGAGGAGGAGTAGGG + Intronic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941392124 2:164927146-164927168 CTGCATCTTCACGAGGAGGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942499821 2:176577883-176577905 CTGTAGTATCAGGGGGAGGAGGG - Intergenic
942571830 2:177322902-177322924 CTGCTTCAGCAGGAGGAAGGAGG + Intronic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
944499369 2:200342456-200342478 CAGCATCAGACGGAGGAGGAAGG - Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945502499 2:210593372-210593394 AAACAGCAGCAGGAGAAGGAGGG + Intronic
945855838 2:215068709-215068731 AGGCAGCAGCAGGAGGAAAAGGG - Intronic
945943813 2:215975100-215975122 CTGCAGTAGAAGTAGGTGGAGGG - Intronic
946027198 2:216679080-216679102 CTGCAGGAGAAGGAGCCGGAGGG + Intronic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946366136 2:219250223-219250245 CAGCAGCAGCATGAAGGGGAAGG + Exonic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947636634 2:231683643-231683665 CTGCAGCAGGAAGGGCAGGAGGG + Intergenic
948024391 2:234765285-234765307 GTGCAGCAGGTGGAGGAGGCTGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948216700 2:236237766-236237788 CTGCAGCAGCAGGCGGACGCAGG + Exonic
948257841 2:236580921-236580943 CCCCAGCAGCAGGAAGAAGATGG + Exonic
948424893 2:237880983-237881005 GGGCAGGGGCAGGAGGAGGAGGG - Intronic
948599257 2:239099155-239099177 CTCCACCAGCAGAAGGATGAAGG - Intronic
948648295 2:239422835-239422857 GTGAAGCAGGAGGAGCAGGAAGG + Intergenic
948883191 2:240870691-240870713 CTGCAGGAGGTGGAGGAGGTAGG + Exonic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1168799387 20:634575-634597 CTGCAGCTTGAGGAGGAGGAAGG + Intergenic
1168943923 20:1735886-1735908 CGGCCGCAGCAGGAGAGGGAGGG - Intergenic
1169118832 20:3083546-3083568 CCGCAGCAGGGCGAGGAGGAAGG - Intronic
1169121769 20:3100937-3100959 CTGAAGCGGGAGGAGGAGGTTGG - Intergenic
1170190503 20:13640380-13640402 GTGAAGCAGCAAGAGCAGGAAGG + Intergenic
1170531875 20:17301317-17301339 AAGCAGCTGGAGGAGGAGGAGGG + Intronic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170779057 20:19407248-19407270 CAGCAGCAGCACTAAGAGGATGG + Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1171130907 20:22652275-22652297 CTGCAGAAAAAAGAGGAGGATGG - Intergenic
1172100802 20:32483282-32483304 CGGCAGCAGCCGGAGAAGGGGGG + Intronic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172399775 20:34639939-34639961 CTGCAGCAGTGGTAGCAGGAAGG + Intronic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1172754434 20:37273301-37273323 CTGCAGTAGATGGATGAGGAAGG + Intergenic
1172887459 20:38240831-38240853 CTGCAGCTGCAGGAGAAGCTGGG + Exonic
1173106975 20:40146103-40146125 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1173137587 20:40453048-40453070 CTGAAGGATCAAGAGGAGGAGGG - Intergenic
1173322974 20:42005978-42006000 CAGCAGCAGCATGTGGAGTAAGG - Intergenic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1173750091 20:45469816-45469838 CAGCAGCAGGCTGAGGAGGAGGG - Exonic
1173865071 20:46308113-46308135 CTCCAGCCGCAGGAGGAGCCGGG - Intronic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174140001 20:48406059-48406081 CTTCACCAGCAGGAGGAGTTGGG + Intergenic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1175073392 20:56353616-56353638 CAGGAGCAGCAGGAGGGGGTGGG - Intergenic
1175315736 20:58045326-58045348 GGGCAGCAGGAGGATGAGGAAGG + Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175819535 20:61901204-61901226 GAGCAGGAGCAGGAGGAGTAGGG + Intronic
1175889312 20:62309419-62309441 CTGCGGCTGCATGAGGAGGCTGG - Exonic
1175894835 20:62331410-62331432 GTGCAGCTGGAGGAGGAGCAAGG - Intronic
1175942949 20:62546293-62546315 CGGGTGCAGGAGGAGGAGGATGG + Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176151643 20:63594478-63594500 CTGCCCCAGCAGGACGTGGAAGG + Intronic
1176218163 20:63957882-63957904 CTGGAGGAGCCGGAGGTGGAGGG - Exonic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176299923 21:5094765-5094787 CTGCTGCAGCCAGAGGGGGACGG + Intergenic
1176362059 21:6006177-6006199 CTCCAAAAGGAGGAGGAGGAGGG + Intergenic
1176857033 21:13981524-13981546 CTGCAGCAGCGGGGGGGGGGGGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177760645 21:25399303-25399325 CTCCAGCAGCAGCAAGTGGAGGG + Intergenic
1177989344 21:28019153-28019175 CTTGAACAGCAGGAGAAGGATGG - Intergenic
1178070508 21:28960819-28960841 CTTCAGGAGGAGGAGGAGGGGGG - Intronic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1178840646 21:36135331-36135353 GTGCAGCAGCTGCAGGCGGAGGG + Exonic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179150652 21:38805882-38805904 CTTCAGGAGCGGGAGGAGGAGGG - Intronic
1179164525 21:38925193-38925215 TTGCAGCTGCAGGGGAAGGAAGG + Intergenic
1179344487 21:40544101-40544123 CTGCAGCATCAGCAGGAGTCAGG + Intronic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179761459 21:43532368-43532390 CTCCAAAAGGAGGAGGAGGAGGG - Intronic
1179857099 21:44167146-44167168 CTGCTGCAGCCAGAGGGGGATGG - Intergenic
1179889917 21:44330291-44330313 CTCCCGCAGCAGCAGCAGGATGG + Exonic
1179983046 21:44906305-44906327 CTGCCGCAGCAGGAGAATGTTGG + Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180708498 22:17824117-17824139 TTGCACCAGCAGGAAGAGGGCGG + Intronic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1180885553 22:19240873-19240895 GGGCAGCAGCAGGAGGAGGTTGG + Intronic
1180969247 22:19806482-19806504 TTGCAGCAGCAGGAAGCAGAGGG + Intronic
1181171927 22:21014832-21014854 CAGCAGCAGCAGGGCGGGGAGGG - Intronic
1181322927 22:22022619-22022641 CTGCAGCCTGAGGAGGAGGAAGG - Intergenic
1181433519 22:22896960-22896982 CTGCAGGAGCAGGAGGATGTGGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181529977 22:23511856-23511878 TTCCAGCAGCATGGGGAGGAAGG + Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181886238 22:26024438-26024460 CTGGAGCAGCATGAGCAAGAGGG + Intronic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1183093840 22:35540837-35540859 CAGCAGCTGAAGGAGGAGCAGGG - Intergenic
1183271453 22:36865081-36865103 CTGCAGCAGCAGGACGGGAGTGG - Intronic
1183377909 22:37475740-37475762 CTGCACCTGCAGGAGTTGGAGGG + Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1183945614 22:41324204-41324226 CTGCAGCAGTATGGGGAGGGAGG + Intronic
1184037644 22:41926277-41926299 CTGCAGCCGCAGGAGTCGGTGGG - Exonic
1184298091 22:43538801-43538823 TTACAGCAGCAGTAGGAGGCTGG - Intronic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184479111 22:44736867-44736889 GTGCAGGAGCACGAGGCGGAGGG + Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1185066196 22:48632823-48632845 CTGCAGCCCCAGGCGGAGGCTGG + Intronic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
1185316266 22:50180543-50180565 CTGCAGGAGCAGGAAGACTAAGG - Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
949397203 3:3627321-3627343 CTGCAGCAACAGCAGAGGGAGGG - Intergenic
949562764 3:5218047-5218069 TTCCAGGAGCATGAGGAGGAAGG - Exonic
949709930 3:6861370-6861392 CCGCAGCAGCCGGAGCAGCATGG + Exonic
949766741 3:7535256-7535278 CTGACGCAACTGGAGGAGGATGG + Intronic
949934084 3:9102921-9102943 CAGCAGCAGCAGGCGGGGGCTGG + Intronic
949970105 3:9397225-9397247 CTGCGGCAACCGGAGGGGGAGGG - Intergenic
950151305 3:10689660-10689682 CCTCAGCAGGATGAGGAGGATGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
950866220 3:16191241-16191263 TTCCCGCAGCAGGAGGAAGAAGG - Intronic
951376539 3:21924900-21924922 CTACTGTAGCAGGAGAAGGAGGG - Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951606378 3:24439267-24439289 CTGCAGCAGCTGGAGGGCAAGGG + Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953099905 3:39813631-39813653 CTGCAGTGGCCGGAGGTGGAGGG + Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953422373 3:42764511-42764533 CTGCAGCATCTGGAGGTGGCAGG - Intronic
953782235 3:45881457-45881479 CAGCAGCAGCAGGAATGGGAGGG - Intronic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954121844 3:48504229-48504251 GGGGAGCAGGAGGAGGAGGAGGG + Exonic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954437156 3:50502538-50502560 CAGCAGCAGCAGGCGCAGGCAGG + Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954876441 3:53805868-53805890 ATGCGGGAGGAGGAGGAGGAGGG - Intronic
955008616 3:54992951-54992973 CTGAAGCAGGAGGAAGAGGGAGG + Intronic
955364341 3:58298593-58298615 CTGCAGCAGGGGGTGGAAGAAGG + Intergenic
955435926 3:58899107-58899129 CTGCACCTGTAGGAGGAGGCTGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955960090 3:64331648-64331670 TTGCAGCTCTAGGAGGAGGAAGG + Intronic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
957723901 3:84039441-84039463 CAGCAGCAGCAGTACTAGGAAGG + Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959547988 3:107620538-107620560 CTTTAGCAGCATGAAGAGGATGG + Intronic
959731676 3:109610935-109610957 CAGCAGCTAGAGGAGGAGGATGG + Intergenic
960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG + Intronic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
960583703 3:119301713-119301735 CTGCAGCAGTGGGTGGAGAAAGG + Intronic
960636798 3:119792528-119792550 CTGGGGCAGCTGGAGGAGCACGG - Intronic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961413419 3:126740228-126740250 CTGCAGCTGCAGGAGGGACAAGG - Intronic
961434823 3:126909652-126909674 GGGCAGCTGGAGGAGGAGGAGGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962304509 3:134273556-134273578 TCGCAGCAGGAGGAAGAGGAGGG - Intergenic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
962954650 3:140253231-140253253 GGGCAGGAGTAGGAGGAGGAAGG + Intronic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964848710 3:161070765-161070787 CTACAGCAGCAGGAGGGGAGAGG - Exonic
965550461 3:169959780-169959802 GGGCAGCAGCAGCAGGAAGATGG - Intergenic
965551267 3:169967071-169967093 GTGGAGCAGCAGGGGAAGGAAGG + Intronic
965673811 3:171174026-171174048 CTGCAGAGGAAGGAGGAGCAGGG + Intronic
965954971 3:174358999-174359021 CAGCTGCAGGAGGAGAAGGAAGG + Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966570902 3:181441779-181441801 CTGCTGCTGAATGAGGAGGAGGG + Intergenic
966748739 3:183302451-183302473 CTGCAGCAGAGGGAGCAAGAAGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968509120 4:987606-987628 CGGCAGCAGCAGTAAGACGAGGG - Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968869946 4:3236687-3236709 GAGCAGCGGCAGGAGGATGAAGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969448770 4:7260830-7260852 GAGCAGCAGCAGGAGGAAGAGGG - Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969478645 4:7435187-7435209 CTACTGCAGCAGGGGGAGGGTGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969527020 4:7709031-7709053 CTGCAGCTGCAGGAAAAGGCAGG - Intronic
969657947 4:8508863-8508885 CGGCGGGAGGAGGAGGAGGAAGG - Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
970637187 4:18021995-18022017 CTCCAGCGGGAGGGGGAGGAGGG - Intergenic
971400160 4:26268751-26268773 CTGCAGCAGAGGCGGGAGGAAGG + Intronic
972270118 4:37502725-37502747 CTGCAGCTGCAGGAGGGAGTAGG + Intronic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
972612566 4:40669099-40669121 CTGAAACAGCTGGAGTAGGAAGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973673650 4:53241749-53241771 GTGCAGCAGGAGGAGGGGGAGGG - Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
973981883 4:56314535-56314557 AGGCGGCAGGAGGAGGAGGAAGG + Exonic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975195033 4:71514329-71514351 TGGCTGCAGCAGGAGGAAGAGGG - Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975712185 4:77171790-77171812 CAACAGCAGCATGAGGAGTATGG - Intronic
976086126 4:81408930-81408952 CTCCAGCAGCTAGAGGAAGAAGG - Intergenic
978620231 4:110629789-110629811 CTTCACCCTCAGGAGGAGGACGG - Intronic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
979475874 4:121157086-121157108 CTGCAGCGGGAGGAGGTGGGCGG - Exonic
979475875 4:121157089-121157111 CGGCTGCAGCGGGAGGAGGTGGG - Exonic
979716999 4:123851867-123851889 TGGCGGCAGCAGGAGGAGAAGGG - Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980282146 4:130736451-130736473 CTGCAGCAGCAGGGGAAGCATGG + Intergenic
980888899 4:138793224-138793246 CTGCAGCAGGAGGAAGAGAGAGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
983075862 4:163325898-163325920 CTGCAGCACCAAGAGGAGAGTGG + Exonic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
985208386 4:187565669-187565691 CAGCAGCAGAGGTAGGAGGAAGG - Intergenic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986220626 5:5765758-5765780 CTGCATTATCAGGAAGAGGAGGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
986290051 5:6392571-6392593 CTACAGCAGCAAGAGGAAGCTGG - Intergenic
986290665 5:6396725-6396747 CTCCAGCAGCGGGAGCAGGGAGG + Intergenic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987292869 5:16524881-16524903 CTGCAGGAGCCGGAGGACGCAGG - Intronic
987377665 5:17251545-17251567 GTCTAGCAGCAGGAGGAGGTAGG + Intronic
987447258 5:18035073-18035095 CTGCAGCAGGAAGAAAAGGAGGG - Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988100472 5:26669864-26669886 CTGCTGCCGCATGAGGAGGAAGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
989068921 5:37490294-37490316 TTGCAGCAGCAGTAGTAGGCAGG + Intronic
989134152 5:38136522-38136544 TGGCAGCAGCAATAGGAGGATGG - Intergenic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990601826 5:57366770-57366792 CTTGAGCAGGAAGAGGAGGAAGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991126487 5:63075513-63075535 CTGCAGCAGCATATGGAAGATGG - Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992663666 5:78985165-78985187 CAGCAGCAGCGGGAGGACGACGG + Exonic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993727788 5:91388366-91388388 CTACTGGAGCAGGAGTAGGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994616833 5:102114711-102114733 TAGAAGCAGCAGGAGGTGGAGGG + Intergenic
995250254 5:109984814-109984836 GAGCAGGAGGAGGAGGAGGATGG + Intergenic
996330022 5:122318109-122318131 CTGCACCCACAGGAGGAGGCAGG - Intronic
996432999 5:123401946-123401968 CTGCAGCAGCAGAAGACGGCCGG - Intronic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
997766172 5:136505921-136505943 CTGCAGCTGCAGGAGCAACATGG + Intergenic
997877213 5:137560117-137560139 CTGGAGCAGAGGGAGAAGGAAGG - Intronic
998063400 5:139136935-139136957 CTCCAGCAGAAGGAGGGGGCAGG + Intronic
998102914 5:139449166-139449188 GTGGAGCAGCTGGGGGAGGAAGG + Exonic
998141530 5:139702274-139702296 CTGGAGCAGAAGGAGCAGGGAGG - Intergenic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998454966 5:142264836-142264858 CAGCAGCAGCAGGAGGTGAAGGG - Intergenic
998811020 5:145966009-145966031 GTGCAGAAGCGGGAGGAGGGAGG + Intronic
998887259 5:146707215-146707237 CTGCAGCAGCAGAAGACGGCTGG - Intronic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999361892 5:150992540-150992562 CCGGAGCTGAAGGAGGAGGAGGG + Intergenic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999448420 5:151659850-151659872 CTGCAGCAGGAGTGGGAGGGAGG + Intergenic
999891283 5:155981070-155981092 GTGCAGCAGATGGAGGAGGGCGG + Intronic
1000319088 5:160119405-160119427 CTGCAGCCGGAGTTGGAGGAGGG - Exonic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1000844175 5:166258314-166258336 CTGCAGTTAAAGGAGGAGGAAGG + Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001135282 5:169097699-169097721 GCGCAGCAGCAGTAGCAGGAGGG + Intronic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001670393 5:173468697-173468719 ATTCAGCGGGAGGAGGAGGAAGG + Intergenic
1001699076 5:173693813-173693835 CACCAGAAGCTGGAGGAGGAAGG + Intergenic
1001852500 5:174981700-174981722 CTTTAGCAGCAGGAGGAAGAGGG - Intergenic
1001891725 5:175344869-175344891 CTTCAGTAGCTGGAGAAGGAAGG + Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002055925 5:176597870-176597892 CTGCAGCACCAGGGGAAGCAGGG - Exonic
1002058475 5:176612142-176612164 CGGCACCAGCTGGAGGTGGATGG - Intergenic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1003034824 6:2633387-2633409 CTGCAGGAGCTGGGGGAGGTTGG - Intronic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003115852 6:3283622-3283644 AGGCAGCAGCAGGAGGAAGGGGG - Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003226694 6:4212390-4212412 TTGCAGTAGCTGGAGGAGGAAGG - Intergenic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003414930 6:5898959-5898981 CAGCAGCAGAAGGTGGAGGAAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1003872770 6:10415083-10415105 GCGCAGGAGGAGGAGGAGGAGGG + Exonic
1003873303 6:10417842-10417864 CTGCCGCAGGAGGAGGAAGGAGG - Intronic
1004536211 6:16504954-16504976 TTGCAGGAGGAGGAGGAGGTGGG - Intronic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1005019480 6:21404056-21404078 CAGCAGCAGCTGGAACAGGAGGG - Intergenic
1005391933 6:25342862-25342884 GTGCAGCTGGAGGAGGAGGAAGG - Intronic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005854517 6:29850591-29850613 CTGCAGCAGCGACAGGAGGAGGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006335784 6:33420012-33420034 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1006650191 6:35545037-35545059 GTGAAGCAAGAGGAGGAGGAGGG + Intergenic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1006794448 6:36722677-36722699 CTGGTGCAGCAGGTGCAGGAAGG - Exonic
1007077183 6:39075280-39075302 CTGCTAGAGCAGGAGGAGGGAGG + Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007597944 6:43063115-43063137 CTGCGGCAGTATGATGAGGATGG + Exonic
1007709789 6:43815217-43815239 AGGCAGCAGGAGGAGGTGGATGG + Intergenic
1007810564 6:44482839-44482861 CTTCAGCAGCGGGAGGAAGGGGG + Intergenic
1007856493 6:44863612-44863634 CTGCAGCAGAATGAGCAAGAGGG + Intronic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010792041 6:80075751-80075773 CTACAGCTCAAGGAGGAGGAAGG + Intergenic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011099709 6:83708434-83708456 CAGCAGCGCGAGGAGGAGGAGGG - Intronic
1011194098 6:84764447-84764469 GAGCAGCAGGAGGAGGTGGAAGG - Exonic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012437798 6:99233644-99233666 ATCCATCAGCAGGTGGAGGAAGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1012951326 6:105521181-105521203 CTCCAGCAGCAGGCTAAGGATGG + Intergenic
1013355101 6:109339567-109339589 CTGGTGCTGCAGGAGAAGGATGG + Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013836777 6:114343098-114343120 CGGCAGCTGGAGGAGGAGCACGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014156420 6:118115223-118115245 CTGCAGCAACAGGAGATGAAGGG + Intronic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1014994528 6:128125376-128125398 TGGCAGGAGCAGGAGCAGGATGG - Intronic
1016034762 6:139374281-139374303 GTGCAACAACAGGATGAGGAGGG - Intronic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1016806775 6:148219631-148219653 TTGCCCCAGAAGGAGGAGGAAGG - Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017008178 6:150043335-150043357 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1017708926 6:157148481-157148503 CTGCACCAGCAGCAACAGGAAGG + Intronic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017871960 6:158494015-158494037 CTGCAGCACCCGGAGGGTGAGGG - Intronic
1017949127 6:159120892-159120914 CTGAAGCAATAGCAGGAGGAAGG - Intergenic
1017987916 6:159460668-159460690 CTGGAGCTGCAGGAGCAGGTAGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018494873 6:164338606-164338628 CTACTGCCGAAGGAGGAGGAAGG - Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019100646 6:169626464-169626486 CTGCACCAGCAGGAGGGGCCTGG - Intronic
1019135440 6:169904868-169904890 CTGGAGCTGCAGGAGGGGCAGGG + Intergenic
1019362707 7:613765-613787 CCGGAGCGGCGGGAGGAGGAAGG - Intronic
1019456498 7:1130434-1130456 CTGCAGCAGCAGGCGTGGGCCGG - Intronic
1019524382 7:1474165-1474187 CACCAGCAGCAGGCGGATGAAGG + Exonic
1019534270 7:1520375-1520397 CTGGAACAGAAGGTGGAGGAAGG + Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1020252951 7:6483992-6484014 CTTCAGCAGCAGGATGACGATGG + Exonic
1020288653 7:6706184-6706206 CTGGAGCAGAGAGAGGAGGAAGG + Intronic
1021633018 7:22665226-22665248 CTGCAGCGCCCGGAGGAGGCGGG - Intergenic
1022111348 7:27234304-27234326 CTGCAGGAGCTGGAGGAGGGTGG - Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022478760 7:30729303-30729325 CTACAGGAGGAGGAAGAGGAGGG + Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023130117 7:36994615-36994637 TTGCAGGAGTGGGAGGAGGAAGG - Intronic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024270399 7:47637140-47637162 ATGCAGCGGCTGGAGGAGGGGGG - Intergenic
1024353909 7:48395229-48395251 CTCCAGTTGCAGGTGGAGGATGG + Intronic
1024430802 7:49285864-49285886 CCCCAGCACCTGGAGGAGGAAGG + Intergenic
1024724773 7:52180130-52180152 CTGGAGCAGTAGGTGGAGGGCGG + Intergenic
1025836223 7:65096097-65096119 TTGCAGCAGCCAGTGGAGGAGGG + Intergenic
1025905995 7:65785540-65785562 TTGCAGCAGCCAGTGGAGGAGGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027186935 7:75977992-75978014 CAACAGCTGCTGGAGGAGGAGGG + Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1031207631 7:118781049-118781071 CTGCAACTGCAGGAGGATAATGG - Intergenic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1033127285 7:138717225-138717247 CTGCATCTGCAGGAGGATGGAGG + Intronic
1033300081 7:140177308-140177330 CGGCCGCAGCCGGAGGAGGACGG + Intergenic
1033355508 7:140595860-140595882 TGGCAGCTGGAGGAGGAGGATGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033921958 7:146404757-146404779 CTCCAGCAGAAGGACGAGGAGGG - Intronic
1034129000 7:148698828-148698850 CGGCGGCGGCGGGAGGAGGAGGG + Intronic
1034166415 7:149028370-149028392 CAAGAGCAGCAGGAGCAGGAAGG + Exonic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034281140 7:149855372-149855394 CAGCCGCAGCAGGTTGAGGAGGG - Intronic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1035060025 7:156062355-156062377 CTGCAGGAGCAGGGGGAGTTGGG - Intergenic
1035084868 7:156249425-156249447 CTGGAGCACCACGAGAAGGAAGG + Intergenic
1035127487 7:156619025-156619047 CAGCAGCAGCTGGGGAAGGAAGG + Intergenic
1035301160 7:157898049-157898071 CTCCAGCTGCTGGAGGAGGCTGG + Intronic
1035450835 7:158976014-158976036 GTGCAGCAGCACGGGGAGCACGG - Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035901396 8:3461580-3461602 CTCCATCAGCAGGAAGAGGAAGG + Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036453941 8:8892453-8892475 CTGCAGCAGCTGCCGGGGGAAGG + Exonic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036710292 8:11074200-11074222 CTGCTCCAGCAGGAGCAGAAAGG + Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037769241 8:21789283-21789305 CTGCGGGGGGAGGAGGAGGAGGG - Intronic
1037890555 8:22621811-22621833 CCCCAGCAGCAGGTGCAGGAAGG + Intronic
1038187872 8:25292037-25292059 CTGCTGCAGCTGGCGGAAGAGGG - Exonic
1038243553 8:25832536-25832558 AGGCAGCAGCTGGAGGAGGTGGG - Intergenic
1038520898 8:28231047-28231069 CTCCTGCAGAAGGAGCAGGAAGG - Intergenic
1038579071 8:28731615-28731637 CTGCAGCACCAGGAACAGGCAGG - Intronic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1039873606 8:41567381-41567403 GTTCTGCAGCAGGAGGAGGCCGG - Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040837253 8:51745657-51745679 CTGCACCTGAAGGAGTAGGAAGG - Intronic
1041401373 8:57448768-57448790 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1041441015 8:57896998-57897020 AAGCAGGAGAAGGAGGAGGATGG - Intergenic
1041739741 8:61145563-61145585 CTGATGCAGCAGGAGGGGGAAGG - Intronic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1042956913 8:74260663-74260685 GGGCAGCAGCTGGAGGAGGCTGG + Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043415738 8:80046945-80046967 CAGCAGCGGGAGGAGGAGAAGGG + Intronic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1045192056 8:99893118-99893140 CTGCCGCAGGAGGGGAAGGATGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045709386 8:104965189-104965211 CTGCAGAAGAAGGAGAAGGTGGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046131671 8:109974551-109974573 CCCTAGCGGCAGGAGGAGGAAGG - Exonic
1046480994 8:114818317-114818339 CTGCAGCTGAAGCAGGAGAATGG + Intergenic
1046944888 8:119965257-119965279 CTGCAGCCCAGGGAGGAGGAAGG + Exonic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047366460 8:124216167-124216189 CTACAGGAGCTGGAAGAGGAGGG - Intergenic
1048006328 8:130422217-130422239 CAACAGCTGCAGGTGGAGGAAGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048292817 8:133193358-133193380 CTGCAGTGGAAGGAGGAAGATGG + Intronic
1048317294 8:133371606-133371628 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1048514946 8:135097612-135097634 CTGCTCCAGCAGGGGAAGGAGGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1049018379 8:139937508-139937530 CTTCAGGAGCAGGCGGAGGCTGG + Intronic
1049237267 8:141518587-141518609 GGGCAGCAGCAGGACGAGGCCGG - Exonic
1049288579 8:141789939-141789961 CGGCAGCGGCAGGTGGAGCAGGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049540946 8:143208537-143208559 CTGCAGGAACAGGAGAAGGCAGG - Intergenic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1049684548 8:143934092-143934114 CTGCAGCAGCAGCACAGGGAAGG + Intronic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1049788458 8:144462443-144462465 CTACAGCTGCAGGAGGCGGCCGG - Intronic
1049792729 8:144479386-144479408 CTCGAGCACCAGGAGGGGGAAGG - Intronic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049818340 8:144618946-144618968 CTGCAGGACGAGGATGAGGACGG - Intergenic
1049820366 8:144629757-144629779 CTGCGACAGGAAGAGGAGGAGGG + Intergenic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1050325036 9:4490433-4490455 CGGCGGCAGCAGGAGGAGCCGGG + Exonic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053575557 9:39355561-39355583 CAGCAGGAGGGGGAGGAGGAGGG - Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054863645 9:69978045-69978067 CTCCAGCAGCAGGCGGACCAGGG - Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056491760 9:87115363-87115385 AGGCAGCAGCAAGTGGAGGATGG - Intergenic
1056841361 9:90000220-90000242 CTGCAGGAGCAGCAGGGAGAGGG - Intergenic
1056906050 9:90648756-90648778 CAGCAGCCCCAGTAGGAGGAGGG - Intergenic
1057039283 9:91835727-91835749 TTGCAGCTGCAGGAGGCGGAAGG + Intronic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057353903 9:94320278-94320300 GAGCAGCCGCAGGAAGAGGACGG - Exonic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057621378 9:96639036-96639058 GAGCAGGAGGAGGAGGAGGAGGG + Intergenic
1057653847 9:96937312-96937334 GAGCAGCCGCAGGAAGAGGACGG + Exonic
1059072458 9:111152943-111152965 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1059506729 9:114806009-114806031 CTCCAGGAGCAGCAGGAGCATGG - Exonic
1059565387 9:115379454-115379476 CTGCTGCAGCAGGAGCAAGTGGG + Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060301047 9:122374841-122374863 CTCCAGGAGTAGGAGGAGGAGGG + Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060750471 9:126165279-126165301 CTGCAGGAACAGGAGGAAGTGGG - Intergenic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061062844 9:128259213-128259235 CTGCAGCAGCAGGAAGCTCAGGG - Exonic
1061601461 9:131673000-131673022 CTGAAGCAGAAGGAAGAGCAGGG - Intronic
1061794792 9:133080081-133080103 CTGCAGGAGCAGGAGAACTAAGG - Intronic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1062403878 9:136384352-136384374 GTGGGGCAGCAGGAGGAGCACGG + Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062460094 9:136659400-136659422 CTGCAGGAGGTGCAGGAGGAGGG - Exonic
1062499954 9:136848057-136848079 CTGCAGCGGCTGGAGGCGAAGGG - Exonic
1062583456 9:137238227-137238249 CGACAGCTGCAGGAGGAGGAGGG + Intergenic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1062678082 9:137760063-137760085 CAGCAGCAACAGGAGGCAGAGGG + Intronic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1186332242 X:8547032-8547054 AGACAGCAGTAGGAGGAGGAAGG - Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188426443 X:30052826-30052848 CTCCAGCAGCAGTTGAAGGAGGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1189364739 X:40379946-40379968 CTGCAGGAGGAGGAAGAGGGAGG - Intergenic
1189656344 X:43248786-43248808 CGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1189759887 X:44310447-44310469 GTGCAGCAGCGGGACGCGGACGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190382337 X:49851962-49851984 CTGCTGCAGCGGGATGACGATGG + Intergenic
1190635042 X:52425017-52425039 CTGCAGCAGCAGTAACAGCAAGG + Intergenic
1190650514 X:52564135-52564157 AGGCAGCAGCTTGAGGAGGATGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192207799 X:69107599-69107621 AGGCAGCAGCAGGAGGGAGAGGG + Intergenic
1192550412 X:72049058-72049080 GAGCAGGAGGAGGAGGAGGAGGG + Intergenic
1192611757 X:72573702-72573724 CTGCAGAAACAAGAGGAGGTAGG - Intergenic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195720436 X:107862149-107862171 TAGCAGGAGGAGGAGGAGGAGGG + Intronic
1195923175 X:110002639-110002661 CTGCTGCAGGGGGAGGAAGACGG + Intronic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196195297 X:112832938-112832960 AGGCAACAGCAGGAGGAGGAGGG - Intronic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1196900033 X:120373895-120373917 GTGGAGCAGGAGGAGGAGGCGGG - Intronic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198694747 X:139324231-139324253 CTGCTGCAGCAGGTGGGGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic
1199800742 X:151248365-151248387 CTGGAGCAGAGGGAGGGGGAGGG + Intergenic
1199850952 X:151724676-151724698 CTGAAGCTGCAGGAAGGGGAGGG - Intergenic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic