ID: 903422744

View in Genome Browser
Species Human (GRCh38)
Location 1:23230404-23230426
Sequence GAGGTCCACCTGAGTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903422744_903422755 21 Left 903422744 1:23230404-23230426 CCTCCCAGACTCAGGTGGACCTC No data
Right 903422755 1:23230448-23230470 ACTTCAGCCTCCCGAGTAGCTGG 0: 408
1: 13112
2: 148556
3: 308689
4: 212025
903422744_903422758 30 Left 903422744 1:23230404-23230426 CCTCCCAGACTCAGGTGGACCTC No data
Right 903422758 1:23230457-23230479 TCCCGAGTAGCTGGGACTGTAGG 0: 155
1: 5067
2: 76025
3: 204586
4: 270530
903422744_903422756 22 Left 903422744 1:23230404-23230426 CCTCCCAGACTCAGGTGGACCTC No data
Right 903422756 1:23230449-23230471 CTTCAGCCTCCCGAGTAGCTGGG 0: 3656
1: 114895
2: 296870
3: 222573
4: 121722
903422744_903422748 -9 Left 903422744 1:23230404-23230426 CCTCCCAGACTCAGGTGGACCTC No data
Right 903422748 1:23230418-23230440 GTGGACCTCCCAGACTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903422744 Original CRISPR GAGGTCCACCTGAGTCTGGG AGG (reversed) Intergenic
No off target data available for this crispr