ID: 903423181

View in Genome Browser
Species Human (GRCh38)
Location 1:23233382-23233404
Sequence GTTTCCAAGGCACCACTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903423177_903423181 7 Left 903423177 1:23233352-23233374 CCCAGGAAGATCTGGCATCAAAT No data
Right 903423181 1:23233382-23233404 GTTTCCAAGGCACCACTAGTTGG No data
903423178_903423181 6 Left 903423178 1:23233353-23233375 CCAGGAAGATCTGGCATCAAATT No data
Right 903423181 1:23233382-23233404 GTTTCCAAGGCACCACTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903423181 Original CRISPR GTTTCCAAGGCACCACTAGT TGG Intergenic
No off target data available for this crispr