ID: 903426999

View in Genome Browser
Species Human (GRCh38)
Location 1:23261170-23261192
Sequence ATAAGGGGTCTGTACAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903426992_903426999 15 Left 903426992 1:23261132-23261154 CCAACACCTGTAAGGCCTCTAAT No data
Right 903426999 1:23261170-23261192 ATAAGGGGTCTGTACAGCCTGGG No data
903426994_903426999 0 Left 903426994 1:23261147-23261169 CCTCTAATGCTGTATCTGTTTAA No data
Right 903426999 1:23261170-23261192 ATAAGGGGTCTGTACAGCCTGGG No data
903426993_903426999 9 Left 903426993 1:23261138-23261160 CCTGTAAGGCCTCTAATGCTGTA No data
Right 903426999 1:23261170-23261192 ATAAGGGGTCTGTACAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903426999 Original CRISPR ATAAGGGGTCTGTACAGCCT GGG Intergenic
No off target data available for this crispr