ID: 903429701

View in Genome Browser
Species Human (GRCh38)
Location 1:23285315-23285337
Sequence ACTTCTGCTCTTAGACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903429695_903429701 22 Left 903429695 1:23285270-23285292 CCTAGATTGGATTAAGCTAAGAG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 903429701 1:23285315-23285337 ACTTCTGCTCTTAGACATCCTGG 0: 1
1: 0
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903429701 Original CRISPR ACTTCTGCTCTTAGACATCC TGG Intergenic
902041052 1:13492763-13492785 AATTCTTCTCTTACTCATCCAGG + Intronic
903429701 1:23285315-23285337 ACTTCTGCTCTTAGACATCCTGG + Intergenic
904270282 1:29345258-29345280 ATCTCAGCTCTTAAACATCCTGG + Intergenic
905347582 1:37321648-37321670 ACCCATGCTCTTAGAGATCCAGG + Intergenic
905643661 1:39609732-39609754 CCTTCTGCTCTGAGCCCTCCAGG - Intergenic
910777310 1:90889916-90889938 ACTTCTGCTGATACAGATCCAGG - Intergenic
916981609 1:170144099-170144121 ACTTCAGCTCCTTGACATGCAGG + Intergenic
917644087 1:177012816-177012838 ACTTCTGCCCTGAGTGATCCAGG - Intronic
920193680 1:204212097-204212119 GTTTGTGCTGTTAGACATCCGGG - Intronic
921282601 1:213582063-213582085 ACTTTGGCTCTTAGAGATCAGGG + Intergenic
923771891 1:236944778-236944800 TCTCCTTCTCTTAGACAGCCTGG - Intergenic
1063201492 10:3788218-3788240 TCTTCTCCTCTTAGACCTCCAGG + Intergenic
1067989875 10:51199818-51199840 AGCTCTGCTGTTACACATCCTGG + Intronic
1068222772 10:54064544-54064566 ACTTCTCCTCATAAACAGCCTGG - Intronic
1068437488 10:57011424-57011446 ACCTCTACTTTTAGATATCCAGG - Intergenic
1069784671 10:70980117-70980139 CCTTCTGCTCATAGAGCTCCAGG - Intergenic
1070941356 10:80350952-80350974 ACTTCTTCACTCAGACATCTGGG + Intronic
1073518243 10:104098735-104098757 ACTTCTGCTCCCAAACATTCTGG - Intergenic
1074675045 10:115838880-115838902 ACTTATTCTCTGAGAAATCCAGG + Intronic
1074889675 10:117724960-117724982 ACTTCTGCACTGAGACTTCATGG - Intergenic
1075559156 10:123456097-123456119 GCTTCTTGTGTTAGACATCCTGG - Intergenic
1075966070 10:126612726-126612748 ATTTCTCATCTGAGACATCCAGG - Intronic
1078775730 11:14392082-14392104 ACTTCTGCTCTAAGCAATCAGGG - Intergenic
1079202004 11:18384393-18384415 ACTTTTGCCCTTTGAAATCCAGG + Intergenic
1081699578 11:45144696-45144718 GCTTCTGCTCTTTGCCTTCCTGG + Intronic
1087362143 11:97174588-97174610 ACCACTGCTCTTAGAATTCCTGG + Intergenic
1087924243 11:103900996-103901018 ACTGCTGCTCAGAGAAATCCTGG - Intergenic
1088637873 11:111841813-111841835 ACTTTTGCTCTAAGACATTATGG + Intronic
1089859100 11:121572902-121572924 AATGCTGCCGTTAGACATCCTGG - Intronic
1091790622 12:3270015-3270037 TCTGCTGCTCTTTGGCATCCCGG + Intronic
1093251822 12:16814733-16814755 CCCTCTGCTCTTATACATCGTGG - Intergenic
1095723472 12:45426747-45426769 ACTTATTCTCTTAGTGATCCTGG + Intronic
1096019992 12:48316121-48316143 ATAGCTGCTCTTAGACATCCTGG - Intergenic
1098941322 12:76540157-76540179 ACATCTGCACTTTGAAATCCTGG + Intronic
1103590880 12:121991416-121991438 ACTGCTGCTCTTAGACCACAGGG - Intronic
1111927627 13:94479908-94479930 ACTTGTGACCTCAGACATCCTGG + Intergenic
1117186828 14:53247980-53248002 ATTTCTGCTCTTTGAAATACTGG + Intergenic
1120931311 14:89851348-89851370 ACTTGTGATCTTATACATTCTGG - Intronic
1121400606 14:93673852-93673874 ACTTCTGCTCACAGAGATTCAGG - Intronic
1124417379 15:29484072-29484094 CCTTCTGAGCTTTGACATCCTGG - Intronic
1126198271 15:45955684-45955706 ACCTCGGCTCTTGGACTTCCTGG + Intergenic
1130354504 15:83117389-83117411 CCTTCTCCTCTCAGACATTCAGG - Intronic
1131442525 15:92469714-92469736 ATTTCTGTTCTTAGCAATCCAGG + Intergenic
1134026634 16:10958957-10958979 CCTTCTGCACTAAGACATCAAGG - Intronic
1136657387 16:31718204-31718226 AATTCTGCTCTCACACATCCTGG - Intronic
1140627175 16:76808025-76808047 ACATCTCCTGTTAGACATGCTGG + Intergenic
1141850354 16:86640812-86640834 CCTTCTGCTCTTCTACACCCAGG - Intergenic
1142574371 17:896666-896688 ACTTCTCATCTTAGTCACCCCGG + Intronic
1146011891 17:29201194-29201216 CCTTCAGCTCTCAGACTTCCTGG + Intergenic
1146135053 17:30312688-30312710 TCTTCTACTCCTAGACATTCAGG + Intergenic
1148801807 17:50232185-50232207 ACTTCTGCTCTTTGTTCTCCTGG + Intergenic
1149009095 17:51836484-51836506 ACCTCTGCCCTTAGACAGCTTGG - Intronic
1149542217 17:57476229-57476251 ACTTCTGCTCAGAGACCCCCAGG - Intronic
1151993187 17:77591738-77591760 ACTCCTGCCCTGTGACATCCTGG - Intergenic
1155918832 18:31582539-31582561 AATTCTGCTCACAGACATCAAGG + Intergenic
1156667267 18:39423641-39423663 ACTACTCCACTTAGACATTCAGG - Intergenic
1158574617 18:58625679-58625701 AATCCTGCTCTTAGATAACCAGG - Intronic
1158654678 18:59320302-59320324 ACCTTTGCCCTTGGACATCCAGG + Intergenic
1163149471 19:15402424-15402446 ACTGCTGCTCTTAGAGCTGCCGG - Intronic
1163249787 19:16119725-16119747 GCTTCTGCTCTTAGCAATCGTGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
927452987 2:23224577-23224599 ACTTCTGCTCTTGGCCACCCAGG + Intergenic
929760218 2:44800697-44800719 ACTTCTGCCCTTGGAGATGCTGG + Intergenic
933303852 2:80573379-80573401 ACGTATGCTCTTTCACATCCGGG + Intronic
935945518 2:108282779-108282801 CCTTCTGATTTTAGACATTCTGG + Intergenic
937446131 2:121959785-121959807 AGTTATGCTCTTAGACCTTCTGG - Intergenic
938546935 2:132342142-132342164 ACTTCTCCTCCTACACACCCTGG + Intergenic
938954965 2:136288778-136288800 ACATCTGCTCTTAGAAACCAGGG + Intergenic
939212425 2:139193814-139193836 ACTTCTGCCATAAGACATGCAGG - Intergenic
941907103 2:170727237-170727259 ACTTCTCCTCTTCGAGATCATGG - Intergenic
943112817 2:183627067-183627089 ACTTCTGTCCTTAGACATTTAGG - Intergenic
943438496 2:187897055-187897077 TCTTCTGCCCTCAGCCATCCTGG - Intergenic
943854637 2:192773585-192773607 ATTTCTGCCCTTGGACAACCAGG + Intergenic
944847175 2:203680767-203680789 ACTTCTGCTCCTAGGCCTGCAGG + Intergenic
945365383 2:208946490-208946512 ACTCCTTCTCTCAGATATCCTGG + Intergenic
949004221 2:241636572-241636594 GCTCCTGCTCGCAGACATCCAGG + Intronic
1171875800 20:30574875-30574897 ACTTCTCCTCCTACACACCCTGG + Intergenic
1173172552 20:40739232-40739254 AATTGTGCTCTTATAAATCCAGG - Intergenic
1174036830 20:47673675-47673697 ACTTCTGCACTAAGGAATCCAGG - Intronic
1175954387 20:62601035-62601057 GCTTCTGCGCTTTGACATCTGGG - Intergenic
1177765761 21:25455530-25455552 TCTTCTGTTCTTAGAAATGCAGG + Intergenic
1178315132 21:31560613-31560635 ACTACTGCTCTTACAGACCCCGG + Intergenic
1178829043 21:36039950-36039972 CCTTCTGCTGCTAGATATCCAGG - Intronic
1184214453 22:43057501-43057523 ACTTTTGCTCTTTGACATGGTGG + Intronic
950175563 3:10871406-10871428 ACTTCAGCTCCTGGACATTCTGG + Intronic
951217353 3:20038203-20038225 ACTTCTGCTTCAAAACATCCTGG + Intergenic
951845238 3:27077969-27077991 ACTGCTTCTCTTAGACATGAGGG + Intergenic
954735370 3:52703127-52703149 ACTTCTTCTCATATACATCAGGG + Intronic
963532732 3:146491209-146491231 ACTTCTGCTGTTAGACTACTAGG + Intronic
964490563 3:157231359-157231381 ACTTTTCCTCTCAGTCATCCTGG + Intergenic
966609013 3:181849923-181849945 TTTTCTTCTCTTTGACATCCAGG - Intergenic
970625605 4:17875598-17875620 ACTTCTGATATGAGACATTCTGG + Intronic
970768948 4:19586469-19586491 AATTCTGCAGTTAGACATCTTGG + Intergenic
972259519 4:37394352-37394374 GCATCTGCTCTGAGCCATCCTGG - Intronic
974030558 4:56772574-56772596 ATTTCTGCTGTCAGTCATCCTGG - Intergenic
976860777 4:89663534-89663556 ATTTCTGCCTTTAGTCATCCTGG + Intergenic
982562963 4:156953726-156953748 TCTTATGCTCTTAGAGAACCTGG - Intronic
982922187 4:161289950-161289972 ACTTCAGCCCTTTGACCTCCTGG + Intergenic
984869583 4:184314401-184314423 ACTTCCTCTCTTAGACCTCTGGG + Intergenic
988040123 5:25878036-25878058 AGTCTTGCTCTTACACATCCAGG - Intergenic
990243048 5:53834786-53834808 ACTTCTGGAGTTAGACATCGTGG + Intergenic
992778265 5:80106462-80106484 CCTTCTTCTCTTAGACTTTCTGG - Intergenic
994230895 5:97309778-97309800 ACTTCTGCAGTTGGACAACCTGG - Intergenic
995214194 5:109575831-109575853 TCTTCTCCTCTTAGGCATTCAGG + Intergenic
995989739 5:118223110-118223132 ACTTCTGGGCCTGGACATCCAGG + Intergenic
996633121 5:125661123-125661145 TCTTCTGCTCATAGTCATCATGG - Intergenic
997099284 5:130950590-130950612 TCTTCTGCATTTAGATATCCAGG + Intergenic
999824096 5:155257803-155257825 ACTTCAGCTATGAGACATTCTGG - Intergenic
1000799466 5:165706362-165706384 TCTTCTCCTCTTTGACCTCCAGG + Intergenic
1001931974 5:175679616-175679638 ACTCCTGCTTTTAGGCATCTAGG + Intronic
1007335762 6:41153986-41154008 CCTTCTGAGCTTTGACATCCTGG + Exonic
1010693003 6:78932859-78932881 ACTACTGCTCATTGACAACCTGG - Intronic
1011366748 6:86590708-86590730 TCTACTGCTCTCAGACATCAGGG + Intergenic
1012964697 6:105660939-105660961 ACTTGTGCTATTAGACATTTAGG - Intergenic
1016644076 6:146383828-146383850 ACTTCTGCTCCTAGAGATGAGGG + Intronic
1019364098 7:622639-622661 TGTTCTGCTCTTTGACATCATGG - Intronic
1022688990 7:32627266-32627288 ACTTCTGCTCTTTGAAAGACAGG + Intergenic
1023405354 7:39828207-39828229 ATTTCTGTACTTAGACTTCCCGG + Intergenic
1023501253 7:40852010-40852032 ACTTCTGATTTTACACATGCTGG + Intronic
1028910226 7:96199566-96199588 ACTCCTGCTCTTGGACCTTCTGG - Intronic
1029434703 7:100556447-100556469 CCTTCTGCCATTGGACATCCTGG + Intronic
1030573962 7:111263101-111263123 ACTTCTGCTCTGAGAGAGGCGGG + Intronic
1031247741 7:119338286-119338308 ACATCTGTTCTTAGATATCAAGG - Intergenic
1034867021 7:154650452-154650474 CCATCTGCACTTGGACATCCTGG + Intronic
1036735342 8:11309427-11309449 ACTTTTGCTCTTAGATATGTTGG + Intronic
1036779116 8:11633704-11633726 ACTTCTGCTATTCCTCATCCTGG - Intergenic
1037717602 8:21413021-21413043 TCTTCTGCTCCTGGACATCCCGG - Intergenic
1039319749 8:36415339-36415361 ATTTATGCTCTTACAAATCCTGG + Intergenic
1040440658 8:47438195-47438217 ACTTCTGCTCTCAAGCACCCAGG - Intronic
1040654270 8:49486553-49486575 ACTTCAGCAGTTAGACAGCCTGG + Intergenic
1041258530 8:56000298-56000320 CCTTCTGCTCTTTAACATACTGG + Intronic
1043485605 8:80696380-80696402 ACTTCTGGTCTCAAACATTCTGG - Intronic
1043600319 8:81929295-81929317 CCTTGTGCTCTGAGACATGCTGG + Intergenic
1044543823 8:93436866-93436888 CATGCTGCTCATAGACATCCTGG - Intergenic
1051385892 9:16508248-16508270 ACTTCTGGTCAAAGACATCTTGG + Intronic
1052387632 9:27840369-27840391 TGTTCTGCTCTTAGACAGCTGGG - Intergenic
1052474411 9:28940183-28940205 TCTTCTCCTCTTAGACATGCAGG + Intergenic
1055243576 9:74215362-74215384 AAGTCTGCTCTCAGACATACTGG + Intergenic
1055894634 9:81161297-81161319 GCTTCTGCTCTTTGACATTCGGG - Intergenic
1056463346 9:86829297-86829319 ACTTGTGTTCTTAGAAATACTGG + Intergenic
1058785339 9:108381405-108381427 ACTTCTTCTCTTGGGCCTCCGGG - Intergenic
1059422589 9:114201478-114201500 TCTTCTGCTCCTGGCCATCCAGG + Intronic
1060870233 9:127034136-127034158 ACTTCTGGTCTTAGAGAAGCTGG + Intronic
1062125435 9:134858184-134858206 TCTTCTGCTCTCTGACACCCTGG + Intergenic
1186653082 X:11582220-11582242 GCTTCTGCTCTCAGACTCCCTGG - Intronic
1194256880 X:91645975-91645997 ACTTTTGCTCCTAGACCTCCAGG - Intergenic
1195126778 X:101815717-101815739 TCTTCTCCTCCTAGACTTCCAGG + Intergenic
1195356921 X:104047950-104047972 ATTTCTTCTCTTTGACATTCTGG + Intergenic
1195748212 X:108139173-108139195 ACATCTCCTCTTGGACATTCAGG + Intronic
1199532496 X:148866140-148866162 ACTTATGCTCTTAGCCTTCAAGG + Intronic
1200575599 Y:4885242-4885264 ACTTTTCCTCCTAGACCTCCAGG - Intergenic
1200981748 Y:9268949-9268971 CCTTTTGCTCTTTGAAATCCCGG + Intergenic
1202128669 Y:21590774-21590796 CCTTTTGCTCTTTGAAATCCTGG - Intergenic