ID: 903430709

View in Genome Browser
Species Human (GRCh38)
Location 1:23297185-23297207
Sequence TTGTTTTTATTGATGTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903430709_903430711 23 Left 903430709 1:23297185-23297207 CCATGTTACATCAATAAAAACAA No data
Right 903430711 1:23297231-23297253 AATATTGCAAGCCATGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903430709 Original CRISPR TTGTTTTTATTGATGTAACA TGG (reversed) Intergenic
No off target data available for this crispr