ID: 903439072

View in Genome Browser
Species Human (GRCh38)
Location 1:23373741-23373763
Sequence ACCTAGTTCATGAGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903439072 Original CRISPR ACCTAGTTCATGAGGTCAGA GGG Intergenic
900570376 1:3355334-3355356 AATTAATTCGTGAGGTCAGATGG - Intronic
902107613 1:14050815-14050837 GCCTGGCTCATGAGGTTAGAGGG - Intergenic
902559119 1:17265965-17265987 ACCTAGTTTATGAGTCCAGAAGG - Intronic
903439072 1:23373741-23373763 ACCTAGTTCATGAGGTCAGAGGG + Intergenic
903930454 1:26859106-26859128 CCCAAGTTCAGGAGCTCAGACGG - Intergenic
904563172 1:31412335-31412357 CCCTAGCTAAGGAGGTCAGAAGG - Intronic
906142768 1:43543610-43543632 TCAAAGTTCATGAGGTCAGAAGG - Intronic
913319497 1:117578355-117578377 ACCTAGTCGAGGAGGTCTGAGGG - Intergenic
921144335 1:212338543-212338565 AGGTGGATCATGAGGTCAGAAGG + Intronic
923451930 1:234126054-234126076 ACCCAGTTCATGAGTTGTGATGG + Intronic
1068427736 10:56889340-56889362 AGCTTGTTCATGAGGCCAGCTGG - Intergenic
1073942979 10:108719226-108719248 CCCTGGATCATGAGGACAGAGGG - Intergenic
1075425930 10:122341719-122341741 ACCTACTTCATGGGGTCGGGAGG - Intergenic
1078644397 11:13126667-13126689 CCCTATTTCATGTGGTCAGCCGG + Intergenic
1078645164 11:13135439-13135461 TCCTATTTCATGTGGTCAGCTGG - Intergenic
1079661033 11:23036827-23036849 ACCTAGTTCTGGTGGTGAGAAGG + Intergenic
1085376582 11:76067966-76067988 ACTTAGATCCTAAGGTCAGAAGG + Intronic
1085736572 11:79044357-79044379 ATCTAGCTAATCAGGTCAGAGGG + Intronic
1086757648 11:90583817-90583839 AAATAGCTAATGAGGTCAGATGG - Intergenic
1089474578 11:118748277-118748299 TCACAGTTCATGAGGTCAGAGGG - Exonic
1092740416 12:11623323-11623345 ACCCAGTTTCTGAGGCCAGAGGG - Intergenic
1092943482 12:13432137-13432159 TTCTAGGTCATGAGGACAGAAGG - Intergenic
1094139088 12:27162200-27162222 ACCTAGTGGAAGAGGTGAGAAGG - Intergenic
1096677619 12:53234010-53234032 GCCTGGTTCATGAGGACAGGAGG - Intergenic
1102927473 12:116837168-116837190 ACCTAGTCCCTGATGTCAGGAGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105268347 13:18844283-18844305 ACCTGATTCATCAGATCAGAGGG + Intergenic
1111047907 13:82839523-82839545 ACCTTCTTCTTGAGGTCACATGG - Intergenic
1115953599 14:38750133-38750155 GCCAAGTTCAAGAGGGCAGAGGG - Intergenic
1118964440 14:70567058-70567080 CCCTAGGTCATGAGGACAGAGGG - Intergenic
1122842217 14:104471520-104471542 ACCTGGCACAGGAGGTCAGAAGG - Intergenic
1128166187 15:65467200-65467222 TCCAAGTTGATGAAGTCAGAAGG - Exonic
1133873215 16:9708986-9709008 ACCTAGGTCAGGAGGCCAGAAGG + Intergenic
1134616914 16:15658520-15658542 ACTCATTTCATGAGTTCAGAGGG - Intronic
1137870770 16:51947946-51947968 ACAGAGTTCATGATCTCAGAAGG - Intergenic
1139062524 16:63270812-63270834 AGCTATTTCATGAGTTCTGAAGG - Intergenic
1144067232 17:11635575-11635597 ACCTAGCACTTGAAGTCAGAGGG - Intronic
1144175179 17:12698400-12698422 ACCAAGTTCTTGAGGTGAGAGGG + Intronic
1146185922 17:30724178-30724200 TCCTAGTTCTGGAGGCCAGAAGG - Intergenic
1147619350 17:41854706-41854728 ACTTTGTTGATGAGGACAGATGG - Exonic
1148612006 17:48970866-48970888 ACACAGTTAATGAGCTCAGAAGG + Intergenic
1148798972 17:50211147-50211169 AGCTATTTCTTGAGATCAGAGGG - Intergenic
1150889520 17:69131398-69131420 ACCTACTTCCTGAATTCAGAAGG + Intronic
1151702399 17:75750382-75750404 ACCTAGCACAGGTGGTCAGAGGG + Intronic
1153552049 18:6272325-6272347 ACCTCCTTCATGAGGTAGGATGG + Intronic
1160706679 19:533150-533172 ACCTCGTTCTTGGGGCCAGAGGG + Intronic
1160934503 19:1587189-1587211 AGCCAGATCATGAGGTCAGGAGG - Intronic
1162331471 19:10032501-10032523 ATATAGTTCGTGGGGTCAGACGG + Intergenic
1162972854 19:14191551-14191573 TCCTAGTTCTGGAGGCCAGAAGG + Intronic
925171316 2:1751891-1751913 GCCTAGGTGATGAAGTCAGAGGG + Intergenic
928613575 2:33014916-33014938 ACCTAGATCTTGATGTCAGTGGG + Intronic
929498554 2:42469190-42469212 AGCTGGATCACGAGGTCAGAAGG + Intronic
929851090 2:45591245-45591267 ACCTAGTTCATCTGGTCTTATGG + Intronic
931621157 2:64211028-64211050 ACTAAGATTATGAGGTCAGAGGG - Intergenic
931802022 2:65767788-65767810 ACCTTGTTCATTAGGGCAAATGG + Intergenic
932068096 2:68588244-68588266 AACCAGTTGCTGAGGTCAGAAGG - Intronic
933428654 2:82146003-82146025 AGCTAAATAATGAGGTCAGAAGG - Intergenic
934893566 2:98091579-98091601 ACCTACCTCATGAGGTTATAAGG + Intronic
938690343 2:133782648-133782670 AGCCAGTAAATGAGGTCAGAAGG + Intergenic
939647112 2:144713990-144714012 AGCTAGTTTATAAGATCAGATGG - Intergenic
942264277 2:174205522-174205544 CCCTAGTTCCTGAGGTGAAAAGG - Intronic
946496285 2:220199233-220199255 CCCTTGGTCATTAGGTCAGATGG + Intergenic
1175625962 20:60488469-60488491 ACCTGGCACATGAGGTCAGTTGG + Intergenic
1175697256 20:61111836-61111858 ACCCAGTCCCTGAGGCCAGAGGG + Intergenic
1176055520 20:63144435-63144457 GCCTAGTTCATAATGTTAGAGGG + Intergenic
1177436856 21:21065953-21065975 ACCTATTTAATGAGGTCATTTGG - Intronic
1180062814 21:45394242-45394264 AACCAGCTCATGAGGTCAGAGGG + Intergenic
1180122101 21:45760361-45760383 ACCTATTTCAGGAGGAGAGAAGG + Intronic
1181018114 22:20082989-20083011 GCCAAGTCCATGAGGGCAGATGG - Intronic
1182226025 22:28799807-28799829 ACCTACTTCATGAGGTCTTTGGG - Intronic
1183679049 22:39316442-39316464 ACCTAGTTGATGAGCTGAGCAGG - Intronic
950887887 3:16376578-16376600 AGCTACTTCATGAGGGCAGCAGG + Intronic
951288153 3:20841153-20841175 ACATAGTTGAAGATGTCAGAAGG + Intergenic
952031098 3:29143742-29143764 GACTAGTTCAGGAGGTCTGATGG - Intergenic
955834737 3:63042482-63042504 AGCTAGTTCATGAAGGCAGTTGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
960174003 3:114496178-114496200 ACTAAATTCAAGAGGTCAGATGG - Intronic
961502997 3:127350701-127350723 ACCTAGGTGGTGAGGCCAGAGGG - Intergenic
963797808 3:149648658-149648680 GCCAAGTTCCTGAGGCCAGAAGG + Intronic
964231131 3:154469366-154469388 ACCTAGTACAGTAGGTCAGTAGG + Intergenic
964528747 3:157644306-157644328 AACTAGTGAATTAGGTCAGAAGG + Intronic
964590423 3:158357241-158357263 AATGAGTTTATGAGGTCAGAGGG + Intronic
965359779 3:167724593-167724615 ACCAAATTCATGAGTTGAGATGG + Intronic
969658685 4:8513330-8513352 AACGAGTTCATGAGATCTGATGG - Intergenic
974018983 4:56676380-56676402 ACTTAGTTCAAGAGGTCACTTGG - Intronic
974940218 4:68458960-68458982 ACCTAGCTCATTAGGTTAGGAGG + Intronic
981979274 4:150771809-150771831 ACCTTGTTCATGAGCTCACTGGG + Intronic
984364145 4:178776463-178776485 AACTAGTTCATGAGGTGAAAAGG - Intergenic
985202795 4:187501940-187501962 ACCTACTTCAGAAGGGCAGATGG - Intergenic
987861950 5:23500361-23500383 ACCTACTTCAGCAGTTCAGAGGG - Intergenic
988500746 5:31781812-31781834 GCCTATTTCAGGAGGTCAGTTGG + Intronic
994991417 5:107001329-107001351 ACCCAGTCCATGAGCTCAGAGGG + Intergenic
997439922 5:133901993-133902015 ACCTAGGACATGAGCCCAGAGGG - Intergenic
998372864 5:141672409-141672431 AGCTAGGTCAAGATGTCAGAAGG - Intronic
1005692950 6:28324487-28324509 TCCTACTTCAAAAGGTCAGAAGG - Intergenic
1006979425 6:38135021-38135043 ACCTAGTGCCTGATGTCAGGGGG + Intronic
1007741382 6:44011875-44011897 GCCCAGTTCTTGAGTTCAGAAGG - Intergenic
1008157172 6:48030798-48030820 ACCCAGTTTCTGAGTTCAGAGGG - Intronic
1008916954 6:56798536-56798558 ACCTAGTCCAAGAGCTCTGATGG + Intronic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1009828645 6:68900610-68900632 ACTTTGTTCATGAGCTCAGTGGG - Intronic
1011466066 6:87658571-87658593 ATCTACTTCATTAGGTCAGGTGG + Intronic
1012944931 6:105455270-105455292 ACCTGGGTCATAAGGTCAAAAGG - Intergenic
1016051675 6:139536527-139536549 ACCTTGTCCATGAGGTGTGACGG + Intergenic
1016668093 6:146667853-146667875 ACCTAGTTGATGGGGTCATATGG - Intronic
1019735389 7:2647715-2647737 ACCTAGTACATGAGGCCTGATGG + Intronic
1019759192 7:2796744-2796766 ACCCTGTTGATGAGGTAAGAAGG - Intronic
1022857011 7:34324715-34324737 GCCTAGTTCCTGAGATAAGAAGG + Intergenic
1024583488 7:50820581-50820603 ACCAGATTCAAGAGGTCAGATGG - Intergenic
1027521151 7:79209827-79209849 ACATAGTTCATGAAGTCAAAAGG - Intronic
1028823878 7:95246169-95246191 ACCAAGTTCATGGGGACACATGG - Intronic
1033822494 7:145150884-145150906 ACCTAGTTAATGAGCACTGAGGG - Intergenic
1038162770 8:25055900-25055922 CCCTAGGTGATGAGGTCAAAAGG - Intergenic
1041837539 8:62233271-62233293 ACCTAGTCACTGAGGTTAGAAGG - Intergenic
1043168340 8:76932870-76932892 TCATAGATGATGAGGTCAGACGG - Intergenic
1046347588 8:112953789-112953811 ACTTATTTCATGAGGTCATTTGG + Intronic
1049702447 8:144021316-144021338 AACTGGGTCATGAGGGCAGAGGG - Intronic
1052955218 9:34248905-34248927 ACCTCGTTCCTGTGGTCAGTGGG + Intronic
1053051506 9:34964782-34964804 TTCCAGTTCATGAAGTCAGACGG + Intronic
1057943200 9:99302836-99302858 TCCTGGTTCCTGGGGTCAGAGGG - Intergenic
1059585528 9:115601985-115602007 CCCTATTTTATGAAGTCAGAAGG + Intergenic
1186300391 X:8194486-8194508 ACCTATTTCATTAACTCAGAGGG - Intergenic
1187076753 X:15943294-15943316 AGGTAGATCATGAGGTCAGGAGG - Intergenic
1187966139 X:24614217-24614239 ACCTTGTTTGTGAGGTCACAAGG - Intronic
1199654864 X:149984229-149984251 AACTAGTTCATGAGGGTACAAGG + Intergenic
1199912879 X:152307041-152307063 ACCTCATTCATGAGGTACGAAGG - Intronic