ID: 903440272

View in Genome Browser
Species Human (GRCh38)
Location 1:23382864-23382886
Sequence CTTATTGAGCACTTAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903440272_903440278 29 Left 903440272 1:23382864-23382886 CCCATCCCTAAGTGCTCAATAAG 0: 1
1: 0
2: 0
3: 19
4: 111
Right 903440278 1:23382916-23382938 GGTTTTTACCTTAAAAAATATGG 0: 1
1: 0
2: 1
3: 57
4: 517
903440272_903440277 8 Left 903440272 1:23382864-23382886 CCCATCCCTAAGTGCTCAATAAG 0: 1
1: 0
2: 0
3: 19
4: 111
Right 903440277 1:23382895-23382917 GGAAAAAATACATAATCATCTGG 0: 1
1: 0
2: 2
3: 36
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903440272 Original CRISPR CTTATTGAGCACTTAGGGAT GGG (reversed) Intronic