ID: 903443870

View in Genome Browser
Species Human (GRCh38)
Location 1:23408322-23408344
Sequence CTGTTGCCCCATCACTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903443870_903443872 -2 Left 903443870 1:23408322-23408344 CCCTGACAGTGATGGGGCAACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 903443872 1:23408343-23408365 AGCAACCAGTCAGCCACCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 140
903443870_903443875 3 Left 903443870 1:23408322-23408344 CCCTGACAGTGATGGGGCAACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 903443875 1:23408348-23408370 CCAGTCAGCCACCCCAGGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 232
903443870_903443881 23 Left 903443870 1:23408322-23408344 CCCTGACAGTGATGGGGCAACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 903443881 1:23408368-23408390 AGGAGCCACACCCCTGATTCGGG 0: 1
1: 0
2: 2
3: 21
4: 153
903443870_903443880 22 Left 903443870 1:23408322-23408344 CCCTGACAGTGATGGGGCAACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 903443880 1:23408367-23408389 AAGGAGCCACACCCCTGATTCGG 0: 1
1: 0
2: 1
3: 4
4: 101
903443870_903443883 25 Left 903443870 1:23408322-23408344 CCCTGACAGTGATGGGGCAACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 903443883 1:23408370-23408392 GAGCCACACCCCTGATTCGGGGG 0: 1
1: 0
2: 1
3: 0
4: 51
903443870_903443873 -1 Left 903443870 1:23408322-23408344 CCCTGACAGTGATGGGGCAACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 903443873 1:23408344-23408366 GCAACCAGTCAGCCACCCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 121
903443870_903443882 24 Left 903443870 1:23408322-23408344 CCCTGACAGTGATGGGGCAACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 903443882 1:23408369-23408391 GGAGCCACACCCCTGATTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903443870 Original CRISPR CTGTTGCCCCATCACTGTCA GGG (reversed) Intronic
900415259 1:2531772-2531794 CTGCTGTCCCAGCACTGTCCTGG - Intergenic
903443870 1:23408322-23408344 CTGTTGCCCCATCACTGTCAGGG - Intronic
906880267 1:49582241-49582263 GGATTGCCCCATAACTGTCATGG - Intronic
910113089 1:83702575-83702597 CCATTGCCCCATCAAGGTCAAGG - Intergenic
912175929 1:107156754-107156776 CTCTTTCCCCATGACTGACACGG - Intronic
912681508 1:111732090-111732112 CTCCTGCCCCACCACTGTCCTGG - Intronic
915480062 1:156178338-156178360 CTCTCCCCCCATCACTGCCAGGG + Intergenic
916075159 1:161196391-161196413 CTGAGGACCCAGCACTGTCAGGG + Intronic
917725616 1:177824761-177824783 CTGATGCAGCATCACTTTCAGGG + Intergenic
917916339 1:179706115-179706137 ATCTTGCCCAATCAATGTCATGG - Intergenic
918157077 1:181858522-181858544 TTATGGCCCCAACACTGTCAGGG - Intergenic
920274219 1:204792009-204792031 CTGTTTCCCCAGCACCCTCAGGG - Intergenic
920333153 1:205226885-205226907 GTGTGGCCCCTTCACTGTCTAGG + Intergenic
920522348 1:206636866-206636888 CTGTGGCTCCACCACTGTAAGGG - Intronic
920679153 1:208059564-208059586 GTCGTGCCCCATCACTGTTATGG + Intronic
921590217 1:216994369-216994391 CGGGTGCCCCATCACTGGGAGGG - Intronic
1062916900 10:1247590-1247612 CTGATGCCTCATCACCCTCATGG - Intronic
1066615320 10:37287876-37287898 CTCTCTCCTCATCACTGTCAGGG + Intronic
1069574464 10:69516923-69516945 CTGTGGCCCCTGCACTGTCTGGG + Intergenic
1070969157 10:80549379-80549401 GTGAGGCCCCATCAATGTCAAGG - Intronic
1070985802 10:80688726-80688748 CTGTTACCCCAGCACTTTCGGGG - Intergenic
1072926706 10:99622059-99622081 CTGTGACCCCAACACTGTGAAGG + Intergenic
1073278231 10:102331524-102331546 CTGTAGTCCCATCACTTTGAGGG + Intronic
1073807000 10:107108998-107109020 CTGTTGCACCATCACCCCCATGG - Intronic
1074678891 10:115882993-115883015 CAGATGCCTCACCACTGTCATGG + Intronic
1074875941 10:117613476-117613498 CTGTTGGCCCTTCTCTGCCAGGG - Intergenic
1075097180 10:119480030-119480052 CTGTTTCCCCAGCACTCTGAAGG + Intergenic
1075930716 10:126293104-126293126 CTGTAGCTCTATCACTGGCATGG + Intronic
1078826600 11:14935881-14935903 CTGTTGCCCAAGCACTGTCCTGG - Intronic
1078949936 11:16118948-16118970 CTTTTCCTCCATCTCTGTCATGG - Intronic
1079111296 11:17606577-17606599 GAGTTGCCCCATCCCTGTCCAGG - Intronic
1084146961 11:67270108-67270130 CGGCTGCCCCTTCACTCTCAGGG + Intronic
1084377953 11:68791303-68791325 CAGTTGCCCCTTCACTGACCAGG - Intronic
1085327424 11:75617781-75617803 CCATTTCCCCGTCACTGTCAGGG + Intronic
1087664621 11:101029917-101029939 TTGTCACCCCATCACTGCCAGGG + Exonic
1089255467 11:117191761-117191783 CTGGTGCCCCACCACGGCCATGG - Intronic
1091978522 12:4846735-4846757 CTGTTGCTTCACCACTGTCCTGG + Intronic
1093340484 12:17967429-17967451 CAGTTTCCCCAGCACTGGCAGGG + Intergenic
1096680814 12:53254023-53254045 CTGTTTTTCGATCACTGTCATGG - Exonic
1098705088 12:73677172-73677194 ATATTGATCCATCACTGTCATGG + Intergenic
1099188207 12:79538908-79538930 CTGTAATCCCATCACTGCCAAGG + Intergenic
1102212537 12:111137883-111137905 CTGTTCTGCCATCAATGTCAGGG - Intronic
1103457956 12:121080931-121080953 CTTTTGACCCAACACTGTAATGG + Intergenic
1107257050 13:38440508-38440530 TTGTTTCCTAATCACTGTCATGG - Intergenic
1108077225 13:46693772-46693794 CTGTTTCCCCATGACTTTTAAGG + Intronic
1108276844 13:48819606-48819628 CTGTTGCCCCATTGCTGTTCAGG + Intergenic
1109791232 13:67250526-67250548 GTGTTGCCCCATTACAGTGATGG - Intergenic
1112588709 13:100744081-100744103 CTGTTGCCCCATCTGTGGAATGG + Intergenic
1113633334 13:111902911-111902933 CTGTTGCTCCAGCACTTACACGG + Intergenic
1113876709 13:113599260-113599282 CTGGTGCCTCGTCCCTGTCACGG + Intronic
1114387852 14:22273494-22273516 CTGGTGCTCCATGACAGTCAGGG - Intergenic
1114546530 14:23506718-23506740 CTGATGTCCCAGCACTGTCCTGG + Intronic
1114635866 14:24186451-24186473 CTGTTCCACCTTCTCTGTCAAGG - Exonic
1115942769 14:38627679-38627701 CTCTTGCACCAGCACTGCCATGG + Intergenic
1119259511 14:73229160-73229182 CTGTGCCTCCAGCACTGTCAAGG + Intergenic
1122060990 14:99136606-99136628 CTGTGGCCCCATCAATGACATGG + Intergenic
1122137749 14:99644721-99644743 GTGTTGCCCCAGGACTCTCAGGG - Intergenic
1122959701 14:105088715-105088737 CTGTTTCCCCATCTCTGCAAAGG + Intergenic
1124877999 15:33613491-33613513 CCCTTGCACCATCACTGTCCTGG - Intronic
1129197532 15:73979087-73979109 CTTTTTCCCCCTCACTGTAATGG - Exonic
1130830212 15:87591617-87591639 CTGTCTCTCCATCACTGTCTTGG + Intergenic
1132858160 16:2056724-2056746 CTGTCGCACCATCAACGTCAAGG + Exonic
1133229945 16:4361654-4361676 CTGCTGCCCCCTCACTCTCTGGG - Intronic
1133850599 16:9499785-9499807 CAGTTGCCCCATCAATATAATGG - Intergenic
1134666375 16:16021992-16022014 TTGTTTTCCCATCACTCTCAGGG + Intronic
1135502122 16:23005390-23005412 CTGTTGACCCAACCCTGTCAGGG + Intergenic
1140267179 16:73430677-73430699 CTGTTGCCCCATTTCAGTGATGG - Intergenic
1141625862 16:85260777-85260799 CTGTTGCCCCTGCACTGTACTGG + Intergenic
1141961784 16:87413750-87413772 ATGTTGACCCATCAGTGACATGG - Intronic
1147219520 17:38920212-38920234 ATGTTTCCCCATCTCTGTCTGGG + Exonic
1147637714 17:41974181-41974203 CTGTGGCCCCATCCCTGGCTTGG - Exonic
1148447622 17:47747732-47747754 ATGTTGCCCCACCACAGTCCAGG + Intergenic
1148506943 17:48134958-48134980 CTGTAGTCCCAGCACTTTCAAGG - Intronic
1152400213 17:80061655-80061677 CTGTTGCCCCCGCACTGTTCTGG - Intronic
1152555186 17:81049548-81049570 CCCCTGCCCCAGCACTGTCAGGG + Intronic
1153160217 18:2196317-2196339 CAGTTGCTCCATCTCTCTCAGGG + Intergenic
1154314092 18:13290185-13290207 CTGTTTCCCCATAATTCTCAGGG + Intronic
1157284746 18:46370037-46370059 CTGTGGCCCCCTCAATGTGAAGG + Intronic
1159919850 18:74217617-74217639 CTGTTGCCTCATAACTCTGAGGG - Intergenic
1160503800 18:79416390-79416412 CTGTTCCCCCAACACTGCCGGGG - Intronic
1163157410 19:15447042-15447064 CAGTTTCCCCATCTCTGACACGG + Intronic
1164964314 19:32468219-32468241 CTGTTGCGTCATCCATGTCATGG + Intronic
1168276776 19:55283345-55283367 CTGTGTCCCCACCAATGTCAAGG - Intronic
931898973 2:66766831-66766853 CTGTGACCCCTTCACTTTCAAGG + Intergenic
932423046 2:71612664-71612686 CTGCCCCCCCATCACCGTCAAGG + Exonic
934160653 2:89246135-89246157 CTGTTTCCCCATCCCAATCAAGG + Intergenic
935827128 2:106962929-106962951 CTGTGATCCCAGCACTGTCAAGG + Intergenic
936518720 2:113198728-113198750 CCTTTGCCCCAGCACTGCCAAGG + Exonic
936908934 2:117570739-117570761 CACTTGCCCCATCTCTTTCAGGG + Intergenic
937858664 2:126691283-126691305 CTGCTGCCCCCTCACTCTCAAGG + Intronic
937859165 2:126694868-126694890 CTGCTGCCCCCTCACTTTCAAGG + Intronic
938923120 2:136013575-136013597 CTGTTGTCCCCTCTCTGACAGGG + Intergenic
939247659 2:139646010-139646032 CTGTAGCCCCATGACTGTGATGG + Intergenic
939950628 2:148468538-148468560 CTGCTGCCCAATCTCTGTCGGGG - Exonic
942318959 2:174719068-174719090 CTGTTGCCCCATCAGGGTCCTGG + Intergenic
942371136 2:175286640-175286662 CTGTTGCTCCTTCTCTGTGATGG + Intergenic
942668241 2:178345592-178345614 CTGTTACCACATCAGTGTCATGG - Intronic
943650907 2:190456650-190456672 ATGGTGCCCCATCCCTGACAAGG + Intronic
948681672 2:239639374-239639396 CTCTTGTCCAATCACAGTCATGG - Intergenic
948727462 2:239943886-239943908 CTTTAGCTCCATCACTGTCCAGG - Intronic
1169134582 20:3189656-3189678 CTGTTTCCCCATCACCATCCAGG + Intergenic
1172384229 20:34522273-34522295 CTGTTTCCCCATCACTAACATGG + Intronic
1179504627 21:41832484-41832506 CCGTTGCCACAGCACTGTAAAGG - Intronic
1179965149 21:44799960-44799982 CTGTTTCCCCATCTCTCTCCCGG - Intronic
1180259422 21:46658448-46658470 CTCTTGTCCCATCTCAGTCACGG - Intronic
1180941492 22:19662184-19662206 CTGTTGCCCCAGCTCACTCAGGG - Intergenic
1183327472 22:37202292-37202314 CTTTGGCCCCATGACTTTCAGGG + Intergenic
1183341006 22:37281490-37281512 CTGTTTCCCCATTACTCTCCAGG - Intergenic
1184677758 22:46053012-46053034 CTCTTTCCCCAGCACTGGCATGG + Intronic
1184771455 22:46599063-46599085 CTGATCCTCCATCTCTGTCACGG - Intronic
950463671 3:13140633-13140655 TTATTGCCCCATCTCTGTCTGGG - Intergenic
951810751 3:26696649-26696671 CTGTGGGCCCCTCACTGTGAGGG + Intronic
954127187 3:48538565-48538587 CCGTAGCCTCATCACTGTCGCGG + Exonic
956657449 3:71566268-71566290 CTATTTCCCCACCTCTGTCAGGG - Intronic
956973824 3:74557356-74557378 CAGTTTTCCCATCACTGTGATGG + Intergenic
958771722 3:98433755-98433777 CTGTCTCCCAATCACTATCAGGG + Intergenic
959610821 3:108292936-108292958 CTGTTGCCTCAACAATGTCCAGG + Intergenic
961417772 3:126773444-126773466 CCTTTGCCCTATCGCTGTCATGG - Intronic
963559704 3:146848039-146848061 TTGTTGGACCATAACTGTCAAGG - Intergenic
964753815 3:160076775-160076797 CTCTTGCACTATCACCGTCATGG - Intergenic
966307543 3:178553644-178553666 CTCTTGCCTCATCACTCCCAGGG + Intronic
968597454 4:1492779-1492801 CTGCTGGTTCATCACTGTCATGG + Intergenic
969636164 4:8370511-8370533 CTCTTCCCCCATCCCTGTCCTGG - Intronic
969717481 4:8874839-8874861 CTGTCTCCCCATCCCTGTGAGGG + Intergenic
973107192 4:46354894-46354916 GTTTTGCCCCATCTGTGTCATGG + Intronic
975620175 4:76289238-76289260 CTTTCTCCCCATCACTTTCAGGG + Intronic
979502307 4:121454619-121454641 CTGCTGCCCCCTCACAGTCTGGG + Intergenic
979821751 4:125182339-125182361 CTTTTGCACAATCCCTGTCACGG + Intergenic
982224946 4:153156570-153156592 CTGGTGCCCCATCTCTTGCAGGG + Intronic
984711931 4:182893071-182893093 CAGTTGCCTCGTCACTATCATGG + Exonic
988548631 5:32180323-32180345 ATGTTGCCCCTTTACAGTCATGG + Intergenic
988713773 5:33804348-33804370 CTGCACCCCCATCACTGCCATGG + Intronic
990337713 5:54791665-54791687 CTGCAGCTCCAGCACTGTCAAGG + Intergenic
990798037 5:59566218-59566240 GTGATGATCCATCACTGTCAGGG + Intronic
990935223 5:61140674-61140696 ATGTTTCACCATCACTTTCAGGG + Intronic
991548220 5:67807229-67807251 ATCTTGCACCATCCCTGTCATGG - Intergenic
991574169 5:68085423-68085445 CTTTTGCCCCTTCTCTGTCCTGG - Intergenic
998303429 5:141049276-141049298 CTCTTGCTCCATCATAGTCATGG - Intergenic
999786160 5:154892499-154892521 CTGTTGGCTCAGCACTGCCAGGG + Exonic
1000166828 5:158658015-158658037 CTGTGGCTCCAGCAATGTCATGG - Intergenic
1001509631 5:172310707-172310729 GTGGTGCTCCATCACTCTCAGGG - Intergenic
1002360110 5:178663693-178663715 CTGAATCCACATCACTGTCAGGG - Intergenic
1005813510 6:29532913-29532935 CTGGTGCCCCTTCCCTTTCAGGG - Intergenic
1007937199 6:45743165-45743187 CTGTTGAGCCCTCACTGTCTAGG + Intergenic
1008378310 6:50816284-50816306 CTGTTGCCCGTTCAATGACAGGG + Intergenic
1010157171 6:72808590-72808612 CTAGTGCCCCAGCACTTTCAAGG + Intronic
1011969688 6:93207665-93207687 CTGTAGCACCTTGACTGTCAGGG + Intergenic
1018460896 6:163997340-163997362 CTGTTGCCCAACGGCTGTCAGGG + Intergenic
1020153415 7:5701717-5701739 CTGTTGCTGCATCACAGTGAGGG - Intronic
1020895750 7:13937142-13937164 CTGTTGCTCCATCAATGCAACGG + Intronic
1021538292 7:21729040-21729062 CTATTTCCCCCTCACTTTCAGGG - Intronic
1022019158 7:26381957-26381979 CTGTTGTCCCATGAGTATCATGG - Intergenic
1022769526 7:33454311-33454333 CTGTTGCCCTATCACTCACTTGG + Intronic
1026419777 7:70222263-70222285 CTGTTGCCACTTCAGTGTCAGGG + Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1030164052 7:106535241-106535263 CTTTGACCCCATCACTGTCAGGG - Intergenic
1035555252 8:562872-562894 CTGTGGCCCCACAGCTGTCAAGG + Intergenic
1044107526 8:88229648-88229670 CTGTGGCCCCTTCACTGACTGGG - Intronic
1047430378 8:124786037-124786059 ATGTTGCCTCATCCCTTTCAGGG - Intergenic
1047885159 8:129242041-129242063 CTTTTGTCCCTTCACTATCAAGG - Intergenic
1048442688 8:134471526-134471548 CTCTTTCCCCATCTCTGCCATGG - Intergenic
1048882182 8:138880209-138880231 CTCTTCAGCCATCACTGTCATGG - Intronic
1049269744 8:141688251-141688273 CTGTTACCCCATCCCTATCAGGG + Intergenic
1050021743 9:1291783-1291805 CTCCTGCTCCAGCACTGTCATGG - Intergenic
1052058788 9:23934473-23934495 CTGTTTCCCCAGCAATGGCATGG - Intergenic
1052327329 9:27229254-27229276 CTGTTTCCCTTTCACTGGCATGG + Exonic
1053013455 9:34648325-34648347 CTGCTGGCCCATACCTGTCAAGG - Exonic
1053292447 9:36890319-36890341 CTCTTGCCCCAGGGCTGTCAAGG - Intronic
1055132871 9:72795160-72795182 CTTTTTCCCCATCCCTTTCAGGG - Intronic
1059327418 9:113512653-113512675 CTGTTCCCCCCTCGCTGCCAGGG + Intronic
1059443473 9:114323936-114323958 CTCTTGCCCCAGGACTGTGATGG + Intronic
1062091996 9:134683196-134683218 CTGTAGCCTCAGCACTGCCACGG - Intronic
1062452168 9:136620374-136620396 CTGTGGCCCGAGCTCTGTCAGGG - Intergenic
1187567985 X:20471550-20471572 CTGTTGACCCATCAGAGTAAAGG + Intergenic
1189744553 X:44156882-44156904 ATGTTGCCCTGGCACTGTCATGG - Intronic
1192189948 X:68984817-68984839 CTCTTGCCACATGACTGGCATGG - Intergenic
1193776622 X:85650213-85650235 CTTTTGCCCCAGTACTTTCAGGG - Intergenic
1195326792 X:103764867-103764889 CCCTTGCCCCATGACTGTTATGG - Intergenic
1198080728 X:133236829-133236851 CAGTTGCCCAATCACCCTCAAGG + Intergenic
1199503475 X:148535743-148535765 CTGCAGCCCCCTAACTGTCATGG + Intronic
1200093489 X:153646828-153646850 CAGTGGCCCCATCTCTGTAATGG - Intronic