ID: 903444340

View in Genome Browser
Species Human (GRCh38)
Location 1:23411667-23411689
Sequence AGTTATAAGATAATGCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903444339_903444340 0 Left 903444339 1:23411644-23411666 CCTAGCAAGCTCACTTCAAGGAC 0: 15
1: 15
2: 9
3: 28
4: 192
Right 903444340 1:23411667-23411689 AGTTATAAGATAATGCTGTTTGG 0: 1
1: 1
2: 0
3: 19
4: 244
903444337_903444340 6 Left 903444337 1:23411638-23411660 CCTCTGCCTAGCAAGCTCACTTC 0: 13
1: 19
2: 9
3: 23
4: 224
Right 903444340 1:23411667-23411689 AGTTATAAGATAATGCTGTTTGG 0: 1
1: 1
2: 0
3: 19
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903444340 Original CRISPR AGTTATAAGATAATGCTGTT TGG Intronic
901833465 1:11908419-11908441 AGTTATAATATTAAGATGTTGGG + Intergenic
903444340 1:23411667-23411689 AGTTATAAGATAATGCTGTTTGG + Intronic
905767167 1:40610671-40610693 ATTTATAAGGTAATGGGGTTTGG + Intergenic
906674492 1:47683332-47683354 ACTTGTAAAATAAGGCTGTTAGG + Intergenic
906674852 1:47686121-47686143 ATTTGTAAAATAAGGCTGTTAGG + Intergenic
907268357 1:53276258-53276280 AGCTATAAGAGAAAGCTGCTGGG + Intronic
908112971 1:60915416-60915438 AGTTACAAGATGATGTTCTTAGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
911613629 1:99984326-99984348 AGTGAGAACATAATGATGTTTGG + Intronic
912084897 1:105987340-105987362 AGATCTAAAATAATGCTGTGAGG - Intergenic
912232276 1:107808421-107808443 TGTTGTAAGAAAATGATGTTTGG - Intronic
912988920 1:114464198-114464220 AGTTATAAGAAAAACATGTTTGG - Intronic
915546229 1:156599843-156599865 AGTCATAAGATAATGGTACTCGG + Intronic
916155531 1:161842618-161842640 AGTGAGAATATAACGCTGTTTGG - Intronic
918271337 1:182903846-182903868 AGTTATCAGATGTTGCTGTTAGG - Intronic
919309010 1:195882224-195882246 AGTTATAAGATAAGACCGATAGG + Intergenic
919629814 1:199949460-199949482 AGTTAAAATCTAATGCTGTAAGG - Intergenic
920616762 1:207500656-207500678 AATTATAATATACTGCTATTTGG + Intronic
920633261 1:207673696-207673718 AATTATAATATACTGCTATTCGG + Intronic
921439464 1:215167630-215167652 AGTTTTTAGATATTGCTTTTTGG + Intronic
923114420 1:230921857-230921879 GGGTATTGGATAATGCTGTTGGG - Intronic
924087761 1:240471097-240471119 AGTTAAAAGAAGATGCTATTTGG - Intronic
1063273485 10:4538186-4538208 AGTGAGAAGATACTGCTGTGAGG + Intergenic
1063981831 10:11459040-11459062 AGTTTTAAGATTATGGTTTTAGG - Intronic
1065311680 10:24422422-24422444 TATTATAAGAAAATGCTGTGAGG - Intronic
1065477458 10:26155839-26155861 AGTGGTATGATAATGGTGTTGGG - Intronic
1065999679 10:31092578-31092600 AGATATAAGCCTATGCTGTTGGG - Intergenic
1067844121 10:49705493-49705515 ATTAATAAGATAATTCAGTTTGG + Intronic
1067868167 10:49930585-49930607 ATTTATAAGAAAAGGCTGTGTGG - Intronic
1069365102 10:67688142-67688164 AGTTTTCAGATGATCCTGTTAGG - Intronic
1069645723 10:69995092-69995114 AGGGATAAGTTACTGCTGTTTGG - Intergenic
1071607047 10:87001703-87001725 CATTATAAGATAATGCTGGCTGG - Intergenic
1072256520 10:93626513-93626535 TGTTATAATATAATGTGGTTGGG + Intronic
1074030334 10:109681275-109681297 AGTTATAATATGATGCTTCTTGG - Intergenic
1075146317 10:119885807-119885829 AGTTTTCAGATAATCCTGATAGG + Intronic
1076132575 10:128023898-128023920 AGTGACAAGATAATTGTGTTTGG - Intronic
1077680088 11:4231690-4231712 TGTTATAATAAAATGATGTTAGG + Intergenic
1078492393 11:11781533-11781555 AGTTATAAGGTAGTGCTGCCTGG + Intergenic
1078917280 11:15791048-15791070 GGTTAAAATATAATGGTGTTGGG + Intergenic
1079193523 11:18303036-18303058 ACTTCTAAAACAATGCTGTTAGG - Intronic
1079763450 11:24358611-24358633 AATTATAAGATAATAGTGTAAGG - Intergenic
1080651947 11:34229862-34229884 TGCCATAAGAAAATGCTGTTTGG - Intronic
1081208067 11:40298048-40298070 ACGTCTAAGATAATGCTCTTAGG + Intronic
1081222664 11:40480971-40480993 AGTTATAAGATGAAGAAGTTTGG + Intronic
1082617587 11:55380049-55380071 TGTTATAAGACAATGGTGGTAGG + Intergenic
1082730834 11:56795651-56795673 AGTGAGAATATAATGATGTTTGG - Intergenic
1083523932 11:63343285-63343307 CGTTATAAGAAAATGCTGATAGG + Intronic
1085753779 11:79187118-79187140 AATGATATGATAATGCTTTTGGG + Intronic
1086163013 11:83744439-83744461 AATTATAAGGTATTGCTTTTTGG + Intronic
1086603088 11:88659647-88659669 AGTTATAAAATAATTATGATAGG + Intronic
1087991996 11:104756793-104756815 AATTAAAAGATAATTTTGTTAGG + Intergenic
1088374599 11:109126343-109126365 TGTTAACTGATAATGCTGTTTGG - Intergenic
1092998310 12:13971931-13971953 AGTTAAAAAAAAATGCTGTTGGG - Intronic
1093503155 12:19835474-19835496 AATTTTATGATAATGCTGATGGG + Intergenic
1094641512 12:32280391-32280413 AGTGATAAGACAAAGCAGTTTGG + Intronic
1097887164 12:64740611-64740633 AGTTTTTAGATAATGCATTTAGG - Exonic
1099154223 12:79154635-79154657 ATTTAGAAAATAATGGTGTTGGG + Intronic
1099205876 12:79725805-79725827 ATTTATAAGAATATGCTGGTTGG - Intergenic
1099423337 12:82492191-82492213 ATATATAAGATCATGCTGTCTGG - Intergenic
1099665648 12:85625676-85625698 AGTTATAGGTTAATGCTGAAGGG - Intergenic
1099792614 12:87356057-87356079 AGTTATAATGAAATGCTTTTCGG + Intergenic
1100115938 12:91304248-91304270 TGTTATAAAATAATAATGTTAGG + Intergenic
1101179979 12:102205498-102205520 ACTTTTAAAATAATTCTGTTTGG - Intergenic
1103105670 12:118222681-118222703 AGTGAGAATATAATGCTGTTTGG - Intronic
1103432126 12:120897379-120897401 AGTACTATGATAATGTTGTTTGG - Intronic
1104871719 12:132003586-132003608 AGTAAGAAGATAATTCTGTAAGG - Intronic
1105895718 13:24715988-24716010 GTTAATAAGATCATGCTGTTAGG - Intergenic
1107007438 13:35630003-35630025 AGTTGCAAGTTAATCCTGTTGGG + Intronic
1108815907 13:54289550-54289572 AGCTTTAAGAAAATGCTTTTGGG - Intergenic
1108904211 13:55449412-55449434 ATTGATAACATTATGCTGTTTGG + Intergenic
1109040349 13:57327192-57327214 TGTTAAAAGATAATTCAGTTTGG + Intergenic
1109177166 13:59170793-59170815 AATGATAAGAAAATACTGTTGGG + Intergenic
1109501023 13:63236160-63236182 AGTTTTCAGATGATCCTGTTAGG + Intergenic
1109988843 13:70026884-70026906 TGTTAGAAGATTATGCAGTTGGG + Intronic
1110848139 13:80213137-80213159 AGTTATAAGATAAATAAGTTTGG + Intergenic
1111210658 13:85074278-85074300 AGGTATTAGATAATGCTTTGAGG + Intergenic
1111640861 13:90968089-90968111 TGTTATAAGATAAAGCTAATGGG + Intergenic
1115817860 14:37182071-37182093 ATTTATAGGAGAATGCTATTTGG - Intergenic
1116019955 14:39448279-39448301 GGTAATAAGATAATGCTGCTTGG - Intergenic
1116590589 14:46767012-46767034 AGTTATAAAATAATGCAGGATGG + Intergenic
1117455508 14:55893162-55893184 GGTTATAAGAAAATGGTTTTGGG + Intergenic
1117885103 14:60352833-60352855 ATTTTTAAGGTAATGCTGTATGG - Intergenic
1118164565 14:63323697-63323719 AATTAAAATATAATGATGTTGGG + Intergenic
1118244786 14:64099106-64099128 AGTTTTGAGAGCATGCTGTTTGG + Intronic
1120086589 14:80281884-80281906 ATTAATAATATAATGCTATTTGG + Intronic
1120265853 14:82250099-82250121 ATTTATGAGATACTGCTGTCTGG + Intergenic
1124422201 15:29532576-29532598 GGTTAGAAGATGATGCTGTTTGG - Intronic
1129317612 15:74754870-74754892 AGTGAGAAGATGATGCTGTTTGG + Exonic
1129554804 15:76496320-76496342 AAATATAAGACAATGCTCTTGGG + Intronic
1133594218 16:7274981-7275003 AATTAGAAGCTAATGCTTTTGGG - Intronic
1136706763 16:32196363-32196385 AGTTATTACATAATGATCTTTGG - Intergenic
1136761148 16:32733055-32733077 AGTTATTACATAATGATCTTTGG + Intergenic
1136806955 16:33137331-33137353 AGTTATTACATAATGATCTTTGG - Intergenic
1203063300 16_KI270728v1_random:993371-993393 AGTTATTACATAATGATCTTTGG + Intergenic
1142831420 17:2551980-2552002 AGTTATAAAACAATTCTCTTTGG + Intergenic
1147519596 17:41157949-41157971 ATTTATAAGAAAATGCTCTCAGG - Intergenic
1147853205 17:43458446-43458468 AGGTGTAACATAATGCTTTTGGG - Intergenic
1148189999 17:45671821-45671843 AGTTATAATACAATGCCCTTAGG - Intergenic
1149279925 17:55092066-55092088 AGTGAAAAGATAATGATGTTTGG - Intronic
1149480607 17:57000305-57000327 AGTGTTAGGATAATGCTGATGGG + Intronic
1149699057 17:58639938-58639960 ATTTTTAAGATAAAGATGTTTGG + Intronic
1150157251 17:62864506-62864528 AATTATAAGATAATTGCGTTCGG - Intergenic
1150674105 17:67229512-67229534 ATTTATAAGATAGTTGTGTTGGG - Intronic
1150899671 17:69258116-69258138 AGTTATATTTTAATACTGTTTGG - Intronic
1151410935 17:73928808-73928830 TATTATAAGATATTGCTGCTGGG + Intergenic
1153304303 18:3618288-3618310 AATAATAAGATAAGGCTATTTGG + Intronic
1153377064 18:4392552-4392574 AGTTAAAAGAGAGTGCTGCTAGG + Intronic
1155476130 18:26237350-26237372 AGTTTTCAGATAATCCTGATAGG - Intronic
1155554755 18:27006465-27006487 ATTTTTATTATAATGCTGTTTGG + Intronic
1155733963 18:29198293-29198315 AGTGAGAACATAATGATGTTTGG - Intergenic
1158632322 18:59126357-59126379 ATTTAAATGTTAATGCTGTTTGG + Intergenic
1159112478 18:64075211-64075233 AGTGATAAGATAAAGCAGTGTGG - Intergenic
1159225343 18:65526568-65526590 GCTTGTAAGATTATGCTGTTTGG - Intergenic
1159747365 18:72254548-72254570 AGGTATAAGATAATGGGATTTGG + Intergenic
1159922935 18:74242606-74242628 AGTTAAAAGGAAAGGCTGTTAGG + Intergenic
1161258767 19:3323994-3324016 ATTTGTAAAATAAGGCTGTTAGG + Intergenic
927259396 2:21071543-21071565 AGGACCAAGATAATGCTGTTAGG + Intergenic
928630588 2:33187733-33187755 AGATATAAAATAATGCACTTTGG + Intronic
932746454 2:74337581-74337603 AGTTTTAAGAAAATAGTGTTAGG + Intronic
933587630 2:84196484-84196506 ACTACTAAGATACTGCTGTTAGG - Intergenic
938962205 2:136353998-136354020 AGAGTTAAAATAATGCTGTTAGG + Intergenic
939003665 2:136763277-136763299 AGTCATATGGTAATTCTGTTGGG - Intergenic
939109565 2:137991326-137991348 GGTTATAATCTAATGCTGATAGG + Intronic
939358165 2:141131827-141131849 AATTAAAAAAAAATGCTGTTTGG - Intronic
939993046 2:148894198-148894220 AGATAGAAGATAATGGAGTTTGG - Intronic
940191503 2:151045383-151045405 ACTTCTAAGATAAAGCGGTTAGG - Intronic
940596568 2:155801047-155801069 AGTTACAAGATCATGATTTTTGG - Intergenic
940807152 2:158200543-158200565 AGTTAGAACATAATTATGTTAGG - Intronic
941364242 2:164591037-164591059 AGTTCTAATATAAAGCTGATTGG + Intronic
943473862 2:188330438-188330460 AGTTGTAATTTAATTCTGTTTGG - Intronic
945307018 2:208268127-208268149 AGTTATAAGATAATTTTTTCAGG + Intronic
947509655 2:230740148-230740170 AGTGATACTATAATGCAGTTAGG + Intronic
948065975 2:235080596-235080618 AGATAAAAGATAGTTCTGTTTGG - Intergenic
1170200113 20:13733274-13733296 AGCCATAAGATAATACTGTAAGG + Intronic
1170740897 20:19055059-19055081 AGCTGTAAAATAATGCTGTTTGG - Intergenic
1172077387 20:32309595-32309617 AGTTATCAGATATGGCTGTCAGG + Intronic
1174347244 20:49939341-49939363 AGTTAGATGTTAATGCTGTTAGG - Intronic
1174403187 20:50287105-50287127 AATTATATGATAATTGTGTTAGG + Intergenic
1177211341 21:18075795-18075817 ACCTATAAGATAATGGCGTTAGG + Intronic
1177917675 21:27110752-27110774 AGATATATGATAATGTTGCTTGG - Intergenic
1178183239 21:30188645-30188667 GGTTATAAAATAAGCCTGTTAGG + Intergenic
1178212640 21:30554898-30554920 AGATATTAGCTAATGCAGTTGGG + Intronic
950514215 3:13453579-13453601 AGTTATGAGATCATGTTGTAGGG - Intergenic
951824000 3:26846862-26846884 GGTTATAAAAGAATACTGTTTGG + Intergenic
954932143 3:54293435-54293457 AGTGAGAACATAATGATGTTTGG + Intronic
955374321 3:58381668-58381690 AATTATAATATAATGATGTCAGG + Intronic
956582104 3:70825547-70825569 AGTAATAAGATAGGGCTATTTGG + Intergenic
958789136 3:98630852-98630874 AGGTATAGGATAATGCTGGAAGG - Intergenic
959392192 3:105789690-105789712 AATTAAAAGACACTGCTGTTAGG - Intronic
960113960 3:113873997-113874019 ATTTACAAGAAAATTCTGTTTGG + Intronic
960547971 3:118938748-118938770 ACTTATAAGATAATATAGTTTGG + Intronic
961838279 3:129683358-129683380 ATTAATAAGATAATACGGTTGGG - Intronic
962467515 3:135674136-135674158 AGTTATACCATAATACTATTTGG + Intergenic
962468515 3:135683802-135683824 AGTTAAAAAATAATGGTGCTGGG + Intergenic
962725882 3:138226292-138226314 AGGTATAAAATAAAGATGTTAGG - Intronic
964018724 3:151980387-151980409 AGTTAAAATATTATACTGTTAGG - Intergenic
965883655 3:173417664-173417686 ATTTCAAAGATAATGATGTTTGG + Intronic
968854031 4:3105080-3105102 TGTTAGAAGGAAATGCTGTTTGG + Intronic
971602942 4:28619108-28619130 TATTATAAGATGATCCTGTTTGG - Intergenic
972133333 4:35862916-35862938 AGTTTTCAGATAATCCTGATAGG - Intergenic
973537380 4:51896930-51896952 AGGTATAAGATGATGCTGAGAGG - Intronic
973612797 4:52653037-52653059 AGTTTTAAGATCATGGTGATGGG - Intronic
975640209 4:76492923-76492945 AGATAAAAGATGATGCAGTTGGG + Intronic
975926234 4:79457151-79457173 AGATATTAGATACTGTTGTTTGG - Intergenic
976430281 4:84955591-84955613 AGTTATAAGATATTACTAATGGG + Intronic
976735687 4:88306600-88306622 TGTTTTAAGATAATGATCTTTGG + Intergenic
976969790 4:91091177-91091199 AATTATAAGATTATGCGTTTGGG + Intronic
977338034 4:95722329-95722351 AGTCATTAGCTAATGCTTTTAGG + Intergenic
977546427 4:98387218-98387240 TGTTATAAGATTAAGCTTTTTGG - Intronic
977940335 4:102850839-102850861 AGTGAGAACATAATGATGTTTGG - Intronic
978603637 4:110455176-110455198 AGTTACAAGATAAAGATTTTTGG - Intronic
978941093 4:114436568-114436590 AGTAAGAACATAATGATGTTTGG + Intergenic
980142540 4:128937794-128937816 ACTTATAAGTAAATGCTCTTTGG + Intronic
982746321 4:159106486-159106508 ATTTATAAGACAAGGCTGTATGG - Intronic
982750132 4:159151214-159151236 AGTTATACCATACAGCTGTTTGG + Intronic
983300622 4:165920739-165920761 AGTTATATGGTAATGGTGTTTGG + Intronic
983415139 4:167442901-167442923 AGTTATGAGATAATCATTTTAGG + Intergenic
984478411 4:180266351-180266373 ACTTAAAAAATAATGATGTTTGG + Intergenic
987882013 5:23760266-23760288 AGTTTTAAGATAATTCTGGTGGG + Intergenic
989582828 5:43049371-43049393 AGTTATAAGATACCCCTGTCCGG + Intergenic
990453054 5:55955110-55955132 AGTTATAATAAAGTGCTTTTAGG - Intronic
990847657 5:60162004-60162026 AGTTATCAGAAAATGGTGGTAGG - Intronic
991552000 5:67848242-67848264 TATTAGAAGATAATGCTGCTAGG - Intergenic
993064782 5:83083983-83084005 ACTTATATTATAATTCTGTTTGG + Intronic
993276875 5:85871298-85871320 AGTTATTTGATGATGCTGGTGGG - Intergenic
993675093 5:90807330-90807352 AGTGAAAAGATACTGGTGTTAGG - Intronic
994231769 5:97315983-97316005 AGTTTTCAGATAATCCTGTTAGG - Intergenic
994851688 5:105062873-105062895 AGTTTTAAAATATTGCTGTTTGG + Intergenic
996005397 5:118414993-118415015 AGTTATAAGATAAATAAGTTTGG + Intergenic
999380090 5:151115329-151115351 AGTTATAAGAAAATGAGCTTGGG + Intronic
1000230773 5:159313231-159313253 AGATATAAGAAAATTCTGCTGGG - Intergenic
1000603275 5:163300268-163300290 AGTTAAAAAAGAATCCTGTTAGG - Intergenic
1002826126 6:775980-776002 AGTAATGAGATAATGCTGTAAGG - Intergenic
1004463766 6:15864062-15864084 GTTTAGAAGATAATTCTGTTTGG + Intergenic
1008377150 6:50805137-50805159 AGCTATTAGTTAATACTGTTAGG + Intergenic
1008952289 6:57173711-57173733 AGTTAAAAGAAAATCTTGTTAGG + Intronic
1009979947 6:70715968-70715990 AGTGAGAACATAATGATGTTTGG + Intronic
1011078519 6:83463852-83463874 TATTATAAAATAATCCTGTTTGG - Intergenic
1012241376 6:96876697-96876719 TGTTTTAAAATAATGATGTTAGG - Intergenic
1012356901 6:98325621-98325643 ACTTATAAGAAAATGTTGTGAGG + Intergenic
1012360605 6:98373895-98373917 AGTGATAAGATGATGATGATAGG + Intergenic
1012631311 6:101471305-101471327 AATTTTAAGAAAATGCTATTGGG + Intronic
1014841619 6:126226597-126226619 AGTAATAGAATAATGCTTTTTGG + Intergenic
1014910405 6:127085716-127085738 ACTTAAAAGATAATACTCTTAGG - Intergenic
1015068777 6:129063685-129063707 AGCTGTAAGATAATCTTGTTTGG - Intronic
1015106814 6:129546367-129546389 AATTATCAGAAAATGCTATTTGG + Intergenic
1015601326 6:134913807-134913829 AGTGAGAACATAATGATGTTTGG + Intergenic
1017363947 6:153610560-153610582 AGTTAGGAGATAAGGCTGATGGG - Intergenic
1017391034 6:153939621-153939643 AGCTATAAGATAGAGCTCTTTGG - Intergenic
1024909456 7:54428550-54428572 AGTTGGAAGATAATGAGGTTAGG + Intergenic
1025109998 7:56206756-56206778 TGTTATAATATAATGCTATAAGG - Intergenic
1025766592 7:64460309-64460331 AGTTATAAGATAATGCTGTCTGG - Intergenic
1025841726 7:65155542-65155564 AGATATAAAATAAGGCTATTAGG - Intergenic
1025881322 7:65540434-65540456 AGATATAAAATAAGGCTATTAGG + Intergenic
1025892117 7:65662181-65662203 AGATATAAAATAAGGCTATTAGG - Intergenic
1026307839 7:69157587-69157609 TGTTATAATATAATGCTATAAGG + Intergenic
1027553143 7:79626989-79627011 AGTTACAAGATAATTCTCTAAGG + Intergenic
1028059172 7:86288482-86288504 AGTGAGAACATAATGATGTTTGG - Intergenic
1029526327 7:101096348-101096370 AGTGAAAAGAAAATCCTGTTTGG + Intergenic
1031125843 7:117772524-117772546 AGTTATAGGGTAATCCTGTTGGG - Intronic
1031693380 7:124818315-124818337 AGTTATTAAATTATGCTTTTAGG - Intergenic
1032514981 7:132500145-132500167 AATGATAAGATAATGCATTTGGG - Intronic
1033053942 7:138032201-138032223 AGTAAAAATATAAAGCTGTTTGG - Intronic
1033407653 7:141085960-141085982 ATTAATAAGATAATGATGTATGG + Intronic
1036731135 8:11265897-11265919 TGTTTTAAGATAATTATGTTTGG - Intergenic
1037280341 8:17234218-17234240 AGTGATAGGATAATGCTCCTAGG - Intronic
1037379089 8:18265039-18265061 TGGTATTAGATGATGCTGTTTGG - Intergenic
1038650840 8:29401912-29401934 AGATAAAAGATAGTGCAGTTAGG - Intergenic
1040636627 8:49282341-49282363 AGTTATAACAAAATGCTGAAAGG + Intergenic
1040965104 8:53074808-53074830 AGTTTTCAGATAATCCTGATAGG - Intergenic
1041049548 8:53919831-53919853 AAATATAAGACAATGCTGTTAGG - Intronic
1041863205 8:62537611-62537633 AGATATAACAAAATGCAGTTAGG - Intronic
1042046490 8:64658141-64658163 ATCTATAAGGTAATGATGTTAGG - Intronic
1043361170 8:79474182-79474204 AATTATAAGATGATGCAATTTGG - Intergenic
1044005484 8:86932228-86932250 AGTTTTCAGATAATCCTGATAGG - Intronic
1044367081 8:91360440-91360462 AATTATTACAGAATGCTGTTGGG + Intronic
1045078335 8:98595468-98595490 AGTTCTAAGACTATTCTGTTGGG + Intronic
1045142864 8:99306385-99306407 AGTGAGAAAATAATGCTGTTTGG + Intronic
1045844829 8:106622245-106622267 AGTCAAAAGATGATGGTGTTTGG - Intronic
1049089475 8:140503650-140503672 AGTAAAAAGACAAAGCTGTTTGG - Intergenic
1052898995 9:33773938-33773960 AAATATCAGATAATGCTTTTAGG - Intronic
1055530084 9:77175558-77175580 AGTTAGATGATATTGCAGTTTGG + Intergenic
1055947591 9:81705341-81705363 AGTTAAAAGATAATTGGGTTAGG - Intergenic
1058352425 9:104041613-104041635 TGGTTTAAGATAATGCTTTTGGG - Intergenic
1059131835 9:111760078-111760100 GGATATAAATTAATGCTGTTTGG - Intronic
1186321598 X:8432521-8432543 AGTTATAAGATAAAAATGTGTGG + Intergenic
1187100769 X:16189029-16189051 AGTTATAAGTTACTGTTCTTGGG - Intergenic
1190145842 X:47890998-47891020 ACTAATGAGATAATGCTGATTGG - Intronic
1192342977 X:70279396-70279418 ACATATAAAATAATGCAGTTTGG - Intronic
1192629473 X:72765249-72765271 AGATATAAGATTATGTTGTCTGG + Intergenic
1192652237 X:72955565-72955587 AGATATAAGATTATGTTGTCTGG - Intergenic
1193588602 X:83359103-83359125 AGATATAAGATTATGTTGTCTGG - Intergenic
1194211663 X:91077438-91077460 AGTCATAACATAATCCTGTTAGG + Intergenic
1194283127 X:91977435-91977457 AGTTATAAGTCAATGTGGTTTGG - Intronic
1194656805 X:96583118-96583140 AGTGAGAACATAATGATGTTTGG + Intergenic
1195120761 X:101749538-101749560 AGGCATTACATAATGCTGTTTGG - Intergenic
1196305464 X:114097134-114097156 AGTTAAAAGTGAATGCTGTAGGG - Intergenic
1196816851 X:119671811-119671833 TGTTATAACAAGATGCTGTTTGG - Intronic
1197162929 X:123344419-123344441 AGTTATAAGCTAATGGTGAATGG + Intronic
1198174010 X:134136612-134136634 AGATGAAAGCTAATGCTGTTTGG - Intergenic
1198487877 X:137106539-137106561 ATTTATAAGGGAATGCTGTCAGG - Intergenic
1200600704 Y:5201969-5201991 AGTTATAAGTCAATGTGGTTTGG - Intronic
1201447318 Y:14071990-14072012 ATTTACAAGATATTGCTATTAGG - Intergenic
1201911053 Y:19133820-19133842 AGTTTTCAGATAATCCTGATAGG + Intergenic
1201989558 Y:20009199-20009221 AGTTTTCAGATGATGCTGATGGG - Intergenic