ID: 903446397

View in Genome Browser
Species Human (GRCh38)
Location 1:23424939-23424961
Sequence GTCCCCCGGCGCCCCTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903446397_903446409 18 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446409 1:23424980-23425002 GGAGGGCTCTCTGGCGAGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 166
903446397_903446401 -8 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446401 1:23424954-23424976 CGGGGGACCGAAGAGAGATTTGG 0: 1
1: 0
2: 0
3: 3
4: 66
903446397_903446406 1 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446406 1:23424963-23424985 GAAGAGAGATTTGGGAAGGAGGG 0: 1
1: 0
2: 5
3: 104
4: 821
903446397_903446410 21 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446410 1:23424983-23425005 GGGCTCTCTGGCGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 24
4: 254
903446397_903446408 17 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446408 1:23424979-23425001 AGGAGGGCTCTCTGGCGAGCTGG 0: 1
1: 0
2: 0
3: 35
4: 218
903446397_903446407 9 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446407 1:23424971-23424993 ATTTGGGAAGGAGGGCTCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 231
903446397_903446405 0 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446405 1:23424962-23424984 CGAAGAGAGATTTGGGAAGGAGG 0: 1
1: 0
2: 1
3: 33
4: 295
903446397_903446402 -7 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446402 1:23424955-23424977 GGGGGACCGAAGAGAGATTTGGG 0: 1
1: 0
2: 1
3: 4
4: 123
903446397_903446403 -3 Left 903446397 1:23424939-23424961 CCCTTCCAGGGGCGCCGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 903446403 1:23424959-23424981 GACCGAAGAGAGATTTGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903446397 Original CRISPR GTCCCCCGGCGCCCCTGGAA GGG (reversed) Intergenic
900105359 1:978749-978771 GTCCCCAGGCTCCCCTGCTAGGG + Intronic
900126823 1:1072440-1072462 GTCCCCTGGCACCCCTGGCTCGG - Exonic
900245273 1:1633537-1633559 ATCCCCCTGCGCCTCTGGAGCGG + Intronic
900256504 1:1700696-1700718 ATCCCCCTGCGCCTCTGGAGCGG + Intronic
900385468 1:2408654-2408676 GGCCCCAGGCTCCCCTGCAAGGG + Exonic
901087789 1:6622191-6622213 GGCCTCGGGCTCCCCTGGAAGGG + Exonic
901653590 1:10756538-10756560 GATCCCCAGCGCCCCTGGACAGG - Intronic
901686798 1:10947775-10947797 GCCCCCCGGCCAGCCTGGAAGGG + Exonic
902585706 1:17437877-17437899 CTCCCCCCCCGCCCCGGGAAAGG - Intronic
903446397 1:23424939-23424961 GTCCCCCGGCGCCCCTGGAAGGG - Intergenic
904029586 1:27525902-27525924 GTCCCCTGGAGTCCCTGGATGGG - Intergenic
915075592 1:153306134-153306156 GGCCCCCAGCACCCCTGGGATGG - Intronic
918732260 1:188013379-188013401 CTCATCCGGCGCCCATGGAATGG + Intergenic
1063658438 10:8014794-8014816 CTTCCCTGGCGCCTCTGGAAGGG + Exonic
1064126647 10:12667196-12667218 CTCCCCCGGCATCCCTGGAAAGG - Intronic
1075697490 10:124447633-124447655 GCCCCCCGCCGCCCCTGGCTGGG + Exonic
1076999691 11:316343-316365 GTCCCCCGGCACCCCGCGTAGGG - Intergenic
1077187519 11:1241973-1241995 GCTCCCCGTCGTCCCTGGAAGGG - Exonic
1077629005 11:3798011-3798033 GTCCGCCGGCGCTGCTGGGAAGG + Intronic
1078617556 11:12879823-12879845 TACCCCCGGCGCCCCTGGGAAGG - Exonic
1083644795 11:64165909-64165931 GTCCCCCCGCGCCCCCGGCCCGG - Exonic
1084574120 11:69977653-69977675 GTCCCCAGGCCACCCTGGCAGGG - Intergenic
1087811114 11:102609991-102610013 GTCCCCCGAGGCCCATCGAATGG + Exonic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090274199 11:125408352-125408374 CTCCCACGGGGCCCCAGGAAGGG + Intronic
1091490813 12:931080-931102 GTCTCCCAGTGCCCCTGGGAGGG - Intronic
1091563256 12:1630149-1630171 GTCCCCAGGCTCCCCGGGAGGGG - Intronic
1097040409 12:56152927-56152949 CTCTCCCAGCGCCCCTGGCAAGG + Intronic
1117157089 14:52951434-52951456 GGCCACCAGCGCCCCGGGAAAGG - Intronic
1123718302 15:23044869-23044891 GTCCCCCGGCACCTCTGGCCAGG - Intergenic
1125916438 15:43492455-43492477 GTCCATCTGCTCCCCTGGAATGG + Exonic
1126477383 15:49079770-49079792 GTCCCTCTGAGCCCCTGGCAGGG - Intergenic
1128112769 15:65087021-65087043 GCCCCCTGGTGCCCATGGAAGGG - Intergenic
1128452381 15:67813233-67813255 GTCTCCCAGCTCCCCTGCAAGGG + Intergenic
1132532822 16:461891-461913 GTCCCCCAGCCCCTCTTGAATGG + Intronic
1132724946 16:1334420-1334442 GGCGCCCGGGGCCCCGGGAAAGG + Intronic
1132831261 16:1929567-1929589 GTCCTCCGGTGACCCTGGAAGGG + Intergenic
1132933820 16:2471369-2471391 GTCTCCCGGCCTCCCGGGAAGGG - Intergenic
1132995206 16:2819132-2819154 GGCCCCCACAGCCCCTGGAAGGG - Intronic
1133172272 16:3988560-3988582 GTCCCCCACCTGCCCTGGAAAGG - Intronic
1135109321 16:19678346-19678368 GTCCCCAGGTGTCCCTGGCAGGG - Intronic
1136555554 16:31005820-31005842 GTCCCCAGGTGCTTCTGGAAGGG - Intronic
1138385903 16:56635564-56635586 GTCCCGCGGCGCGCCGGGAGTGG + Intergenic
1141140313 16:81492988-81493010 TGCTCCCTGCGCCCCTGGAAGGG + Intronic
1141180041 16:81746273-81746295 GTCCGCCGCCGCCACTGGCAGGG + Intronic
1141375428 16:83525951-83525973 TTCCCCTGGAGCCTCTGGAAAGG + Intronic
1141897094 16:86965068-86965090 CTCCCCCGGAGCCCCAGGAAGGG - Intergenic
1142226125 16:88878428-88878450 GTCCTGGGGCTCCCCTGGAAAGG + Intronic
1142312101 16:89320130-89320152 GTCCCCAGGCCTCCCTGGCAGGG + Intronic
1143431790 17:6893572-6893594 TTCTCCCGGCGGCTCTGGAAAGG - Intronic
1148225587 17:45896157-45896179 GACCCCCGGCACGCATGGAACGG + Intronic
1152239138 17:79152470-79152492 GACCCCCGGCCCAGCTGGAAAGG - Intronic
1160830545 19:1102904-1102926 GACCCCCTGCGCCCATGGCAGGG + Intergenic
1160898158 19:1412504-1412526 GTCCCCCGGCCCAGCAGGAAGGG + Intronic
1161767958 19:6217256-6217278 CTCCCCCAGCCCCCCTGCAAAGG + Intronic
1165156505 19:33792121-33792143 CTCCCCCGACCCCCCTGGAGAGG + Intergenic
1166936277 19:46335056-46335078 GTCCCCCAGCACCTTTGGAATGG - Intronic
1167815418 19:51876585-51876607 GTATCCCGGCCCCTCTGGAAAGG - Intronic
927131164 2:20061932-20061954 GTCCCTCTGTGCCCCTTGAATGG - Intergenic
927205770 2:20609379-20609401 GTCCCCCCGGGCCCCTGGAACGG - Intronic
927512748 2:23654629-23654651 GCCCACCGGCTTCCCTGGAATGG - Intronic
931517805 2:63059861-63059883 GTCCCCCGCCGCCCCCGGCCCGG - Intergenic
932700040 2:73985571-73985593 CTGCCCCGGCGCCCCCGGCACGG - Intergenic
936935663 2:117836432-117836454 GTCTCCCGGCAGCCCTGGGAAGG + Intergenic
936935677 2:117836480-117836502 GTCTCCCGGCAGCCCTGGGAAGG + Intergenic
937296398 2:120812312-120812334 GTCCCCAGGAGCCGCTGGATGGG + Intronic
938058256 2:128233098-128233120 GTCCCCAAGCTCGCCTGGAAGGG - Intergenic
945059084 2:205892907-205892929 GTCCCCGTGGCCCCCTGGAAAGG + Intergenic
946612381 2:221473130-221473152 TTCCCCAGGCTCCCCTGAAACGG - Intronic
948288117 2:236803013-236803035 GTCCCCAGGTGCCCGTGGCAAGG + Intergenic
948726100 2:239935000-239935022 CACCTCTGGCGCCCCTGGAATGG + Intronic
1169116856 20:3071793-3071815 GTCCCGCGGCGCTCCGGGGAGGG + Intronic
1171175593 20:23049239-23049261 GGCCGCCGGCGCCTCTGGATCGG - Exonic
1174042618 20:47710727-47710749 GTCCCCCTGCCCCCTTGGAGAGG + Intronic
1174508809 20:51035362-51035384 CTCCCCCAGCGCCCTGGGAATGG + Intergenic
1175831801 20:61968654-61968676 GGCCCCTGCAGCCCCTGGAAGGG + Intronic
1175915196 20:62422826-62422848 GTCCCCAGGGGCCCCTGACAGGG + Intronic
1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG + Intronic
1180204324 21:46248244-46248266 GTCCCCCTGGGCCCCTGAACAGG + Intronic
1182333881 22:29570352-29570374 GGCCCCCAGAGCCCCTGAAAGGG + Intronic
1183649542 22:39145919-39145941 TTCCCCCGACCCCCCGGGAAAGG - Intronic
1184455930 22:44609424-44609446 GTCCCCAGGGGCCCAAGGAAGGG - Intergenic
1185310950 22:50153922-50153944 GTCCTCCGGGGCCCGTGGCATGG - Intronic
1185376272 22:50483874-50483896 GTCCCCCGTCCCCCCAGGGAAGG - Exonic
961734535 3:128993323-128993345 GGCCGCCGGCGCTCCTGGCAGGG + Exonic
965551168 3:169966707-169966729 GCCGGCTGGCGCCCCTGGAATGG - Intronic
966183039 3:177204125-177204147 GTCCGCCGGCGCCACTGGCCTGG - Intergenic
968962683 4:3753342-3753364 GCCCTCCTGCACCCCTGGAAGGG - Intergenic
969020881 4:4139455-4139477 GTACCCTGGGGCCCCTGGAAAGG - Intergenic
969721108 4:8893468-8893490 GCGGCCCGGCGCCCCGGGAAAGG - Intergenic
969732972 4:8967969-8967991 GTACCCTGGGGCTCCTGGAAAGG + Intergenic
969788155 4:9474364-9474386 GTCGCCCCGCGCCCCTGACATGG - Intergenic
971581079 4:28341916-28341938 TTCCCCCGGCACACCTGGACAGG + Intergenic
972717149 4:41657848-41657870 GTCCCCAGGAGCCCTAGGAAGGG + Intronic
996862730 5:128083978-128084000 CTCCTCCGGCGCCCCGGGACTGG + Exonic
1002949124 6:1791131-1791153 CTCCCCCAGAGCCTCTGGAAGGG + Intronic
1004205713 6:13589906-13589928 GTCCACAGGCGTCCCTGGAAGGG - Intronic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1006388700 6:33746445-33746467 GGCTCCAGGCACCCCTGGAAGGG + Intronic
1006429153 6:33984503-33984525 TTCCCCCAGCGCCCCTGGCCTGG - Intergenic
1007368905 6:41413447-41413469 CTCCCCCGGCGCCCAAGGGAGGG - Intergenic
1013395690 6:109736850-109736872 CTCCCCTGGAGCCTCTGGAAAGG - Intronic
1014798071 6:125748443-125748465 GTCTCCCGGCGCCCCTGGCTGGG + Intronic
1017963187 6:159239871-159239893 GTCCCCCTGGGACCTTGGAACGG + Exonic
1019540735 7:1549981-1550003 GTCCCCCAGGGGCCCAGGAATGG + Intronic
1020109417 7:5439771-5439793 GACCCCAGGAGCCCCAGGAAGGG - Intronic
1028424475 7:90671083-90671105 GTGCCCCGGCTCTCCTGGAATGG + Intronic
1034466432 7:151232638-151232660 GTCTCCCGGCGTCCCGGGAGGGG - Exonic
1035238578 7:157515905-157515927 GGCCCTCGGGGCCCCTGGAGTGG + Intergenic
1035726272 8:1825621-1825643 GTGCCCAGGGGCCCATGGAAGGG - Intronic
1041689993 8:60679096-60679118 TTCGCCCGGCGCCCCCGGGAGGG + Intronic
1048543419 8:135363845-135363867 GTCCCCTAGAGCCTCTGGAAAGG - Intergenic
1049168410 8:141141434-141141456 GTCCCCCGGCTCACCAGGAGAGG - Intronic
1053198275 9:36136477-36136499 TTCCCCACGCGCCCCGGGAAGGG + Intergenic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1056850701 9:90081386-90081408 GTCCCCCAGCAGCCTTGGAATGG - Intergenic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1061747716 9:132752657-132752679 TTCCCCCAGCTCTCCTGGAATGG + Intronic
1185748808 X:2593854-2593876 GTACCCCTGCACCCCTGCAAGGG + Intergenic
1187341600 X:18425890-18425912 GCTCCCCTGCGCCTCTGGAAGGG + Intronic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1198740770 X:139839871-139839893 GTCCTCCGGCTTACCTGGAATGG - Intronic
1199850502 X:151722353-151722375 GCTCCCCGGCGCAGCTGGAATGG + Intronic
1200047831 X:153411872-153411894 TTCCCCTGGCGCCCCTGGTACGG - Intergenic