ID: 903446425

View in Genome Browser
Species Human (GRCh38)
Location 1:23425043-23425065
Sequence GGCGCCCGAGGGTGTCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903446415_903446425 8 Left 903446415 1:23425012-23425034 CCTGGCCACAGGCGGCGGTCGCG No data
Right 903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG No data
903446417_903446425 3 Left 903446417 1:23425017-23425039 CCACAGGCGGCGGTCGCGGCGCG No data
Right 903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903446425 Original CRISPR GGCGCCCGAGGGTGTCCCAG GGG Intergenic