ID: 903446425

View in Genome Browser
Species Human (GRCh38)
Location 1:23425043-23425065
Sequence GGCGCCCGAGGGTGTCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903446417_903446425 3 Left 903446417 1:23425017-23425039 CCACAGGCGGCGGTCGCGGCGCG 0: 1
1: 1
2: 1
3: 24
4: 143
Right 903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 98
903446415_903446425 8 Left 903446415 1:23425012-23425034 CCTGGCCACAGGCGGCGGTCGCG 0: 1
1: 0
2: 1
3: 8
4: 90
Right 903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903446425 Original CRISPR GGCGCCCGAGGGTGTCCCAG GGG Intergenic
900131002 1:1087247-1087269 GGTGCACGTGGGTGTCCCCGTGG - Intronic
900364164 1:2304032-2304054 GGCGCCCGTGGCTGCCCCAGAGG + Exonic
901027596 1:6286870-6286892 GGGGCCTGAGTGTGCCCCAGGGG + Intronic
901060154 1:6468142-6468164 GGGGGCAGAGGGTGTCCCATGGG + Exonic
902663725 1:17923040-17923062 GGCGCCAGAGGCCATCCCAGGGG + Intergenic
903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG + Intergenic
904778264 1:32925110-32925132 GGCGCCCGCGGGGGTCCCTGGGG + Intergenic
906719691 1:47996550-47996572 GGCGCCCGAGGCTGCGCCCGGGG + Intronic
910549739 1:88462728-88462750 GGCGCCCGCGGCAGCCCCAGCGG - Intergenic
910763922 1:90761888-90761910 GGCCCCTGAGGGTGCCCTAGGGG - Intergenic
922468590 1:225861765-225861787 AGCGCCCCAGCGTGCCCCAGGGG + Intronic
1064052256 10:12068977-12068999 GGAGCCCGAGGGGATCCCACCGG - Exonic
1064583509 10:16817193-16817215 GGCGTCCGAGGGCGTCCCAGGGG + Exonic
1073973581 10:109073756-109073778 GGCACCCAAGGGCGTCCAAGAGG - Intergenic
1076111276 10:127861513-127861535 GGCATCCCAGGATGTCCCAGAGG - Intergenic
1076725948 10:132413380-132413402 GGTGCCCGCGGGCGTCCCGGTGG + Intronic
1077947023 11:6911085-6911107 GCCCCCCCAGGGTGTCTCAGAGG + Intergenic
1083769590 11:64859055-64859077 GGCGCTAGGGGCTGTCCCAGTGG - Intronic
1103095676 12:118130623-118130645 GGCCCCTGAGGATGTCCTAGGGG + Intronic
1106037013 13:26052104-26052126 GGCGCCCGCGGGCGTCCCTGAGG - Intergenic
1108541842 13:51452839-51452861 GGCCCCTGTGTGTGTCCCAGCGG + Exonic
1113200995 13:107867333-107867355 GGCGCCCGCGGGCGGCCCTGCGG - Intergenic
1113779643 13:112968852-112968874 GGCACCCGCGGGGCTCCCAGGGG + Intronic
1131435813 15:92420733-92420755 GGCGTCTGAGGGTGTTGCAGGGG - Intronic
1132586063 16:706142-706164 GGCGCCGGCGGGTGGCCCAGGGG + Intronic
1132722188 16:1321850-1321872 GGTGGCCGAGGGTGGCACAGAGG + Intronic
1133760628 16:8795913-8795935 GGCGACCCAGGGTTACCCAGAGG + Exonic
1135546723 16:23371634-23371656 GGCGCCAGAGGGGGCGCCAGAGG - Intronic
1135864706 16:26090626-26090648 GGGCCCCGAGGGTCTCCAAGGGG - Intronic
1137426551 16:48385309-48385331 GGCGGCCCAGGGTGTCCCGTCGG - Intronic
1138044213 16:53704015-53704037 GGCGCTCGCGGGTGTCGCCGCGG + Exonic
1138651278 16:58463115-58463137 GGAGCCCGAGGGTGTCCTTGAGG - Intronic
1140507880 16:75485815-75485837 GGGACCTGATGGTGTCCCAGTGG + Intronic
1142196614 16:88742069-88742091 GTCGCGAGAGGGTCTCCCAGCGG + Exonic
1143582271 17:7834299-7834321 GGCTCCCCAAGGTATCCCAGGGG - Intergenic
1145094227 17:20010045-20010067 GGTGCCCGTGGGTTTCCCGGTGG + Intronic
1147139831 17:38454574-38454596 GGCACACGAGGGTTTCCTAGTGG + Intronic
1149666897 17:58371252-58371274 GGAGGGAGAGGGTGTCCCAGAGG + Intronic
1151869557 17:76827165-76827187 GGGGCCCCTAGGTGTCCCAGTGG + Intergenic
1152111845 17:78360954-78360976 GGCGCCCTGGGGTCTCCTAGGGG + Intergenic
1153576503 18:6527197-6527219 TGCGACCAAGGGTGGCCCAGTGG - Intronic
1160816373 19:1037809-1037831 GGTGCCCGAGGGAGCCCCATCGG - Exonic
1160966553 19:1749324-1749346 GGCGTCCGAGGGTGCCCGAGGGG - Intergenic
1161162684 19:2769756-2769778 GGCACAGGAGGGTGTCCGAGGGG - Intronic
1161324292 19:3656021-3656043 GGGGCCCAAGGGTGACTCAGAGG - Intronic
1162066190 19:8126678-8126700 GGAGCCCGACGGCGTTCCAGAGG - Intronic
1163423501 19:17228062-17228084 GGACCCAGTGGGTGTCCCAGAGG - Intronic
1165253612 19:34559337-34559359 GGCACCTGAGGGGGTCCCGGGGG + Intergenic
1165943727 19:39428787-39428809 GGCGCCCATGGTTTTCCCAGGGG - Intergenic
1166340291 19:42133141-42133163 GGCGCCCGAGGCGGCTCCAGTGG + Intronic
1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG + Intronic
1168103406 19:54153011-54153033 GGGGCCCGAGGCTGCCCCGGGGG - Intronic
926728099 2:16014192-16014214 AGCGCCCGGGCGTGTCCCTGAGG - Intergenic
931671690 2:64653711-64653733 GGGGCCCGAGGGTGGCGCCGGGG + Exonic
935207110 2:100905725-100905747 GGCTCACGAGGCTGTCACAGAGG - Intronic
937338737 2:121077505-121077527 GCCGCTCGAGGGTGGCCCCGTGG + Intergenic
938716746 2:134028166-134028188 GGCGTCCAGTGGTGTCCCAGGGG + Intergenic
947118567 2:226796147-226796169 GGCCCACGAGGCTGTCCCTGGGG - Exonic
1172183432 20:33017136-33017158 GGGGCTCCAGGGGGTCCCAGAGG - Intronic
1172273310 20:33666738-33666760 GGCGCCAGAGGGAGACCAAGAGG + Exonic
1173656360 20:44702919-44702941 GAGGCCTGGGGGTGTCCCAGGGG + Intergenic
1176062571 20:63178802-63178824 GGCGGCCGAGGGCGGCCGAGGGG + Intergenic
1180115864 21:45704503-45704525 GGCGCCCCAGGGGGCTCCAGGGG + Intronic
1180162143 21:46002881-46002903 GGCGCCCAGGGCTGTCCCAGAGG + Intronic
1181522346 22:23456903-23456925 CGAGCCCCATGGTGTCCCAGCGG - Intergenic
1183520633 22:38294412-38294434 GGCCCCCGTGGGTGGGCCAGGGG + Exonic
1184187965 22:42877265-42877287 GGGGCCCTGGGGTGGCCCAGGGG + Intronic
1184422781 22:44391547-44391569 GGCGCCGGATGTTCTCCCAGGGG - Intergenic
1184492897 22:44820465-44820487 GATGCCGGAGGGTGTCCCCGGGG - Intronic
1185284631 22:49994770-49994792 GGCTCCAGAGGGTGGCTCAGCGG + Exonic
952816452 3:37451973-37451995 GGCGCCCCGGCGGGTCCCAGGGG + Intergenic
953482212 3:43261457-43261479 GATGTCCCAGGGTGTCCCAGAGG - Intergenic
960120780 3:113947630-113947652 GGCTCCGGAGGCTGTCCCACCGG + Intergenic
961074922 3:123973402-123973424 TGGGCCTGAGGGTGTCTCAGAGG + Intronic
968926068 4:3549116-3549138 GGCAGCCCAGGGTGCCCCAGTGG + Intergenic
969115526 4:4868543-4868565 GGGGCCGAAGGGGGTCCCAGAGG - Intergenic
969638850 4:8384906-8384928 GGCACCTGAGGGTGTCTCAGAGG - Intronic
985590067 5:759918-759940 GGGGCCCGAGGGGGTCGCTGAGG + Intronic
985649406 5:1100364-1100386 GGCGGCTGCGGGTGGCCCAGGGG - Intronic
998385197 5:141753440-141753462 GGCTTCCGAGGGGGTCCCCGCGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1019512391 7:1424201-1424223 GGCGCAGGAGGCTGGCCCAGTGG + Intergenic
1019529741 7:1497398-1497420 GGCGCCCGAGGGCGCTGCAGTGG + Intronic
1019588981 7:1819661-1819683 CGAGCCCCATGGTGTCCCAGCGG + Intronic
1019611001 7:1936600-1936622 GGCGCCTGAGGCTGCCCCAAAGG + Intronic
1020812601 7:12864676-12864698 GGCTCCCGGGGGGCTCCCAGGGG + Intergenic
1024961382 7:54980688-54980710 GGCGCCCGAGGGCGTCCTGGGGG - Intergenic
1025562023 7:62380845-62380867 GGCCACCGAGGGTGGCGCAGGGG + Intergenic
1026913961 7:74108748-74108770 GACGCCAGAGGGTGTGGCAGAGG + Intronic
1034276967 7:149828113-149828135 GGGGCCAGAGACTGTCCCAGGGG - Intergenic
1036168944 8:6464648-6464670 AGCGCCTGTGGGTCTCCCAGTGG - Intronic
1045815193 8:106270407-106270429 GGCGCCCGGGGGAGTCCAGGAGG + Intronic
1049720972 8:144115387-144115409 GGTGCCCGAGGGTATCACGGAGG - Exonic
1053800996 9:41764522-41764544 GGCAGCCCAGGGTGCCCCAGTGG + Intergenic
1054144201 9:61550315-61550337 GGCAGCCCAGGGTGCCCCAGTGG - Intergenic
1054189427 9:61976672-61976694 GGCAGCCCAGGGTGCCCCAGTGG + Intergenic
1054649088 9:67611937-67611959 GGCAGCCCAGGGTGCCCCAGTGG - Intergenic
1056583833 9:87915127-87915149 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056584325 9:87918596-87918618 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056612544 9:88134326-88134348 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1056613036 9:88137794-88137816 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1060103927 9:120862049-120862071 AGGGCCCTAGGGTGGCCCAGAGG + Intronic
1060929484 9:127479790-127479812 GGCGTCTGAGGGGGTCCCAGGGG + Intronic
1203785706 EBV:126287-126309 GGCCCCCGGGGGTGTCCAAACGG - Intergenic
1185461371 X:334119-334141 AGCGCCAGAGGGTGTCCGTGTGG + Exonic
1186888656 X:13938830-13938852 CTCGCCCGGGGGGGTCCCAGAGG - Intergenic
1193185465 X:78507293-78507315 GGCTTCCCAGGGTTTCCCAGGGG - Intergenic
1194747035 X:97639701-97639723 GGAGCCCGAGGGAGTTTCAGTGG + Intergenic
1200079390 X:153568368-153568390 GGCTACAGATGGTGTCCCAGTGG - Intronic
1200831655 Y:7692029-7692051 GGGGCCCGGGGATGTCTCAGTGG + Intergenic