ID: 903450614

View in Genome Browser
Species Human (GRCh38)
Location 1:23451547-23451569
Sequence CAATTTGCCCAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903450604_903450614 25 Left 903450604 1:23451499-23451521 CCATGCCTTCTCCAGCTGTTTTT 0: 1
1: 0
2: 4
3: 78
4: 643
Right 903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 193
903450606_903450614 20 Left 903450606 1:23451504-23451526 CCTTCTCCAGCTGTTTTTTGGAA 0: 1
1: 0
2: 3
3: 51
4: 655
Right 903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 193
903450611_903450614 -4 Left 903450611 1:23451528-23451550 CCTGTGGGTTAAAAAAGGACAAT 0: 1
1: 0
2: 2
3: 21
4: 190
Right 903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 193
903450607_903450614 14 Left 903450607 1:23451510-23451532 CCAGCTGTTTTTTGGAATCCTGT 0: 1
1: 0
2: 1
3: 21
4: 314
Right 903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 193
903450603_903450614 29 Left 903450603 1:23451495-23451517 CCTTCCATGCCTTCTCCAGCTGT 0: 1
1: 3
2: 5
3: 68
4: 471
Right 903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903450614 Original CRISPR CAATTTGCCCAGAGGGAAGC TGG Intronic
901850247 1:12010526-12010548 CCATTTACCCACAGAGAAGCTGG + Intronic
902961990 1:19970376-19970398 CAATTGACCCAGATGGATGCAGG + Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
905536726 1:38728349-38728371 CGATTTCCCAGGAGGGAAGCAGG - Intergenic
906101955 1:43269748-43269770 CAAGTTGCCCAGACTGAGGCTGG + Intronic
908128012 1:61050072-61050094 CAAATTCCCCTGAGCGAAGCAGG - Intronic
910283689 1:85529887-85529909 CACCTTGCCCAGTGTGAAGCAGG + Intronic
910762389 1:90746798-90746820 TCATTTGCTCTGAGGGAAGCCGG - Intergenic
913968598 1:143396982-143397004 CATTTTGCCCAGGATGAAGCTGG + Intergenic
914062977 1:144222581-144222603 CATTTTGCCCAGGATGAAGCTGG + Intergenic
914116173 1:144743773-144743795 CATTTTGCCCAGGATGAAGCTGG - Intergenic
914206326 1:145533103-145533125 CACCTTGCCCAGTGTGAAGCAGG - Intergenic
917450833 1:175146114-175146136 AAATTTGCCCCCAGGGAAGCTGG + Intronic
919665339 1:200285960-200285982 CAATTTGCCCAAAGTTAAACAGG - Intergenic
920093344 1:203469996-203470018 CAATTTGCACAGAGGGATTTAGG + Intergenic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
922754254 1:228086038-228086060 CAATTTTCCCAGAGTGGAGAGGG + Intronic
922767088 1:228161860-228161882 GTATATGCCCAGTGGGAAGCTGG + Intergenic
924024549 1:239818629-239818651 AAATTTGGACACAGGGAAGCAGG - Intronic
1063602574 10:7495745-7495767 CATTTTACCCAGAGAGAAACAGG + Intergenic
1064606377 10:17045219-17045241 CAATTTCCCCAGAAGGAAAGGGG - Intronic
1067099387 10:43323412-43323434 CGCTTTGCCCGGAGGGAACCTGG - Intergenic
1068789514 10:61011830-61011852 TTATTTGCCCAGAGGTCAGCTGG + Intergenic
1071290968 10:84188864-84188886 CTATTTGCCCAGAGATGAGCTGG - Intergenic
1073674387 10:105628827-105628849 CAATATGCAGAGAGGGAAGCAGG - Intergenic
1074099228 10:110340848-110340870 TAATTTGCCCAGATGGTATCTGG - Intergenic
1075263468 10:120981792-120981814 GAATTTTCCCACAGGGAGGCAGG - Intergenic
1080405293 11:31973317-31973339 CAATTTGCCTAGAGGGCCGAGGG - Intronic
1081343243 11:41952970-41952992 CAATTTTCTCAGAGGGAAAAAGG + Intergenic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1085191209 11:74624894-74624916 TAACTTGCCCAGAGTGAAGCGGG + Intronic
1085775827 11:79365706-79365728 CAACAGGCACAGAGGGAAGCAGG + Intronic
1089108454 11:116035247-116035269 GAATTTGCCCATAGAGAAGTTGG + Intergenic
1089217560 11:116843989-116844011 GAATTTGCACAGAGGAAAGCGGG - Intronic
1091918141 12:4283714-4283736 CATTTTGCCAGGAGGGAGGCGGG + Intronic
1097036304 12:56126733-56126755 CCATATTCCCAGAGGTAAGCAGG - Exonic
1097106816 12:56630526-56630548 CAGTTTGCCCTGTGTGAAGCAGG - Intronic
1097205138 12:57314601-57314623 CAGTTTTCCCAGAGGTTAGCAGG - Intronic
1099217861 12:79875430-79875452 CTATTTGCCCAGAGGGCAAGTGG + Intronic
1100476654 12:94941353-94941375 TATTTTACCAAGAGGGAAGCTGG + Intronic
1104612720 12:130242708-130242730 GAATTAGCCAAGAGGAAAGCAGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105825346 13:24117525-24117547 CAATTTGCCCAGATCTATGCAGG - Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1109107656 13:58275904-58275926 AAATCTACCCAGAGGAAAGCAGG - Intergenic
1110873768 13:80484445-80484467 CAATTTGCCTAGATTCAAGCAGG - Intergenic
1115302475 14:31900124-31900146 CAACTTGCGCAGAGGTAACCGGG - Intergenic
1118358301 14:65034207-65034229 CAATCTGTCCAGACTGAAGCAGG - Intronic
1119200695 14:72749764-72749786 CAACTTCCCCAGATGGCAGCAGG - Intronic
1119513592 14:75230640-75230662 CATTTTGCCTACAAGGAAGCAGG + Intergenic
1122907237 14:104807503-104807525 CAATGGCCCCAGAGGGAGGCAGG - Intergenic
1124089065 15:26580453-26580475 CCATCTGCCAAGAGAGAAGCAGG + Exonic
1125327863 15:38555016-38555038 CAAGGTGCCCAGAGGGCAACAGG - Intronic
1127320604 15:57841470-57841492 AAATTAGGCCAGAGGGAAGGAGG - Intergenic
1128090678 15:64916837-64916859 CAAATAGGCCTGAGGGAAGCTGG - Intronic
1128380599 15:67109310-67109332 CATTTTGCCCTGATTGAAGCTGG + Intronic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1131332513 15:91514944-91514966 CAATTGGCCCAAAGGGATGAGGG + Intergenic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1132514414 16:359591-359613 CACTTTGCCCAGGGGGACACTGG - Intergenic
1133435559 16:5776407-5776429 CAATTCACACAGAGGGATGCAGG - Intergenic
1134291645 16:12906398-12906420 TAATTAGCCCAGAAGCAAGCAGG - Intronic
1134685685 16:16156575-16156597 CACTTTACCCCAAGGGAAGCTGG + Intronic
1137797193 16:51231889-51231911 CAAGTTTCCCAGCGTGAAGCTGG - Intergenic
1138133108 16:54499105-54499127 GCCTTTGCCCAGAGGGAAGCTGG - Intergenic
1138423219 16:56913264-56913286 CACTTTGCCCATAGGGAGGAAGG + Exonic
1138514647 16:57529281-57529303 CCGGTGGCCCAGAGGGAAGCGGG - Exonic
1141872942 16:86801361-86801383 CCATTTGCCCAAACTGAAGCAGG - Intergenic
1145994098 17:29095826-29095848 TAAGTTGCCCAGCGGGGAGCAGG + Intronic
1146373696 17:32280773-32280795 CCATTGCCCCAGAAGGAAGCTGG - Intronic
1146377837 17:32306568-32306590 TAATTTGCCCAGAGTGTAGCAGG - Intronic
1146587422 17:34094159-34094181 CTATTTGCCCAGAGTGACCCTGG - Intronic
1146795223 17:35775625-35775647 CATTTTGCACATAGGGAAACAGG - Intronic
1146916242 17:36680188-36680210 TATTTTCCCCAGAGGGAAGCGGG + Intergenic
1147036585 17:37686177-37686199 CAAGTCGCTCAGAGGGAATCTGG - Intergenic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150374655 17:64670917-64670939 CCATTGCCCCAGAAGGAAGCTGG - Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155357546 18:24967894-24967916 TAATTTTCCCTGATGGAAGCAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156377987 18:36531832-36531854 CAGTTTGCCCACAGGCAGGCTGG + Intronic
1157079110 18:44502549-44502571 GAATTTGCTAAGAGGGAAGAAGG - Intergenic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1158187147 18:54783730-54783752 GCCTATGCCCAGAGGGAAGCAGG - Intronic
1158406367 18:57163268-57163290 CAATTTGAACAGAGGTTAGCAGG - Intergenic
1160608025 18:80066750-80066772 CAATTTGCCCAGACTAAAGCAGG - Intronic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1167528646 19:50001204-50001226 CAGGTTCCCCAGAGGAAAGCAGG - Intronic
1202702387 1_KI270712v1_random:174452-174474 CATTTTGCCCAGGATGAAGCTGG + Intergenic
925214334 2:2081367-2081389 GCATTTGCCAAGAGGGAAGTAGG - Intronic
926886660 2:17604519-17604541 CACTTTCCGCAGAGAGAAGCTGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
927245260 2:20952388-20952410 CAAATGGGCCAGGGGGAAGCAGG - Intergenic
927805995 2:26147260-26147282 CAACCTACCCAGAGGGGAGCAGG + Intergenic
934173299 2:89557906-89557928 CATTTTGCCCAGGATGAAGCTGG + Intergenic
934283614 2:91632259-91632281 CATTTTGCCCAGGATGAAGCTGG + Intergenic
934502124 2:94869916-94869938 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
934935125 2:98459841-98459863 CAACTTGACCTCAGGGAAGCAGG - Intronic
935831342 2:107003950-107003972 CAACTTTTCCAGAGTGAAGCAGG + Intergenic
936075189 2:109397259-109397281 AGATCTGCCCAGAGGGCAGCTGG + Intronic
939456424 2:142442920-142442942 CAATTTGCACATAGAGAATCTGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
1168771391 20:419197-419219 CCACTTGGCCAGATGGAAGCTGG + Intronic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1170408328 20:16063003-16063025 CAATTAACACAAAGGGAAGCCGG + Intergenic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1175748986 20:61482088-61482110 CAATGGGCCCAGAGCAAAGCGGG - Intronic
1176623884 21:9075249-9075271 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1178605157 21:34029865-34029887 CACGTAGCCCAGATGGAAGCGGG + Intergenic
1181061426 22:20283854-20283876 CAATTATCCCTGAGGCAAGCTGG + Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1183779912 22:39992815-39992837 CAATCTGCCCAGTGGGAACTGGG - Intergenic
1184415217 22:44348237-44348259 CATTTTACACAGGGGGAAGCAGG - Intergenic
1185125694 22:49009538-49009560 CAATTTCCAGAGAAGGAAGCAGG - Intergenic
949899799 3:8801976-8801998 CAATTTGCCCAAAGGAAGGAAGG + Intronic
950622266 3:14215393-14215415 CCATTTTCACAGTGGGAAGCTGG - Intergenic
951628014 3:24687941-24687963 CATTTTGCCCAGAGAGAATTTGG + Intergenic
952037087 3:29215702-29215724 TAATTTACCAAGAGGGAATCAGG - Intergenic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
954611767 3:51948116-51948138 CAAGTTTCCCAGAGAGAAGTCGG + Intronic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
956195501 3:66650075-66650097 CAATGTCCCCTGTGGGAAGCTGG - Intergenic
956933024 3:74067605-74067627 CATTTTGCCCAGATTGAAGCTGG + Intergenic
957797251 3:85026710-85026732 GAAGTTACCCAGAGGGAAACTGG + Intronic
958987703 3:100801651-100801673 CAATTTTCCTAGAGGCAAGATGG - Intronic
959345524 3:105190019-105190041 CAATATGCCCAAAAGGAAGATGG - Intergenic
959909499 3:111747928-111747950 CCAGTTGCCCACAGGGAATCAGG - Intronic
960351158 3:116594726-116594748 GGATTTTCCCAAAGGGAAGCTGG - Intronic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
967389456 3:188941246-188941268 CATTTTGCACAAGGGGAAGCGGG + Intergenic
967979402 3:195056610-195056632 CCATTTGCACAGCAGGAAGCAGG + Intergenic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
969827152 4:9766716-9766738 CAGTTTGCCCAGGATGAAGCCGG + Intergenic
969957026 4:10901404-10901426 CAATTTGTTCAGAGTCAAGCAGG - Intergenic
970136685 4:12932870-12932892 CATTTAGCCCAGAGAGAAGAGGG - Intergenic
971102743 4:23485895-23485917 CCACTTGGCCAGAAGGAAGCAGG - Intergenic
971144222 4:23959583-23959605 CAAGTTGCCAAGAGGAAGGCAGG - Intergenic
972847871 4:43011333-43011355 GGATTTGGTCAGAGGGAAGCTGG + Intronic
974189936 4:58491743-58491765 CAGTTTGCACAGAGAGAAACAGG + Intergenic
976483309 4:85570169-85570191 CAATATGCCCAGAGGAAACGTGG - Intronic
978728554 4:111998957-111998979 CAATTAGTCAAGAGTGAAGCAGG + Intergenic
985136294 4:186789023-186789045 CAAATTGCCCATATGTAAGCAGG - Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
988309902 5:29543510-29543532 CAAATTGCCCTTAGGGAAGAGGG - Intergenic
989165654 5:38431416-38431438 TAATTTGCCCAGTGGGGAGCTGG - Intronic
989758479 5:44984763-44984785 CAGTTTGCACTGAAGGAAGCAGG - Intergenic
989952564 5:50316945-50316967 CAGTTTGGCCAGATGGAATCAGG - Intergenic
993013625 5:82511194-82511216 CATTTTGCCCTGAGGGAGACTGG + Intergenic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
994004484 5:94821745-94821767 CAATTGGCCCTGAGGAAACCAGG + Intronic
994102621 5:95910549-95910571 CTATTTGCCTAGAGAGGAGCAGG - Intronic
994283094 5:97929815-97929837 CAACTTGACCTGGGGGAAGCTGG + Intergenic
996992813 5:129656880-129656902 CCATTTGCCAAGAGGCAATCTGG + Intronic
997978906 5:138457061-138457083 CAACTGGACCAGAGGGAAACTGG + Intergenic
1007092571 6:39193395-39193417 CCTTTTGCCCAGAGGGCAGTGGG - Intronic
1009435815 6:63617182-63617204 AAGTTTGTCCAGATGGAAGCAGG - Intergenic
1013300587 6:108801530-108801552 CAATTAGTCCACATGGAAGCTGG - Intergenic
1017821027 6:158049222-158049244 CCCTTTGCCCAGAGGGGAGGAGG + Intronic
1018091069 6:160347694-160347716 AACTTTCCCCAGAGGGCAGCCGG - Intergenic
1018569339 6:165192022-165192044 AAAGTTGGTCAGAGGGAAGCTGG - Intergenic
1020461691 7:8435020-8435042 CAATTTGCATACAGGAAAGCAGG - Intronic
1020967200 7:14886213-14886235 CAATTAGCCAATATGGAAGCTGG + Intronic
1021508687 7:21411948-21411970 CAAGAAGCCCACAGGGAAGCTGG - Intergenic
1022509806 7:30927844-30927866 CACCTGGCCCAGAAGGAAGCAGG + Intergenic
1022592054 7:31672979-31673001 CACTTTGTTCACAGGGAAGCAGG - Intergenic
1023352981 7:39338765-39338787 CAATTTCTGCAGAAGGAAGCTGG - Intronic
1028161559 7:87491764-87491786 CCATTACCCCAGAGGGAAGTGGG + Intergenic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1029984966 7:104914590-104914612 CAATTTGCGGAGAGGGCAGAGGG + Intergenic
1030223808 7:107126547-107126569 AAAGTTGACCAGAGCGAAGCAGG + Intronic
1031020047 7:116617959-116617981 CAATTTTCCCCAAGGGAACCAGG - Intergenic
1032347799 7:131133243-131133265 GAAGTTGCCAGGAGGGAAGCAGG - Intronic
1032856947 7:135842759-135842781 GAATTGGCCAAGAGGGAAGGAGG + Intergenic
1033391997 7:140937443-140937465 AAATTTGACCATAGGGAACCAGG + Intergenic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1037983051 8:23268857-23268879 CAATTTTCAGAGTGGGAAGCGGG + Intergenic
1038148679 8:24922493-24922515 TAATTTGCCCAAAGGGAACCAGG + Intergenic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1040466112 8:47696890-47696912 GCATTTGCTCAGAGGAAAGCTGG - Intronic
1040858819 8:51978078-51978100 AAATTTCCCCAGAGGGACTCTGG + Intergenic
1040946723 8:52892859-52892881 GAAGTTGCCCAGTGGGAAGATGG + Intergenic
1040946732 8:52892901-52892923 GAAGTTGCCCAGCGGGAAGATGG + Intergenic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1048020574 8:130535275-130535297 ATGTTTGCCCAAAGGGAAGCTGG - Intergenic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1049519264 8:143079971-143079993 TCAGTTGCCCAGAGGAAAGCAGG - Intergenic
1050866935 9:10512650-10512672 CAATTTGTTGAGAGGGAAGGAGG + Intronic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1056485687 9:87054945-87054967 CAATTTGCCTAGGGGGACACAGG + Intergenic
1056676275 9:88679321-88679343 TTATTTGCCAAGAGTGAAGCTGG - Intergenic
1057409432 9:94804505-94804527 CAATTTTCCCAGTGGGATGAAGG - Intronic
1059487615 9:114638753-114638775 CAAATTCCCCCGAGGGAAGATGG - Intronic
1059502748 9:114769100-114769122 CAATTTACCCAGAGAGAAAGTGG - Intergenic
1203747069 Un_GL000218v1:45677-45699 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1203563036 Un_KI270744v1:73803-73825 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
1186876657 X:13824556-13824578 AAAATTGTCCAGAGGGCAGCTGG + Intronic
1191952945 X:66614444-66614466 TAATTTGCCCAGAGCAAAGATGG + Intronic
1192248589 X:69392597-69392619 CCATTTGCCCACAGGAAAGAAGG + Intergenic
1201160390 Y:11160672-11160694 CAGTTTCCCCAGATGGCAGCAGG + Intergenic