ID: 903455431

View in Genome Browser
Species Human (GRCh38)
Location 1:23484010-23484032
Sequence CCGAGGGGCGGCGCTGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 386}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903455431_903455450 20 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455450 1:23484053-23484075 GAAGGCGGCGGCCCCAGCCGGGG 0: 1
1: 0
2: 1
3: 29
4: 355
903455431_903455443 -4 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455443 1:23484029-23484051 TCGGTACCGGGGCATCTTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 35
903455431_903455441 -7 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455441 1:23484026-23484048 CCCTCGGTACCGGGGCATCTTGG 0: 1
1: 0
2: 0
3: 4
4: 59
903455431_903455449 19 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455449 1:23484052-23484074 CGAAGGCGGCGGCCCCAGCCGGG 0: 1
1: 0
2: 1
3: 27
4: 263
903455431_903455445 2 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455445 1:23484035-23484057 CCGGGGCATCTTGGCGGCGAAGG 0: 1
1: 0
2: 0
3: 7
4: 77
903455431_903455446 5 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455446 1:23484038-23484060 GGGCATCTTGGCGGCGAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 121
903455431_903455451 28 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455451 1:23484061-23484083 CGGCCCCAGCCGGGGAGCTGAGG 0: 1
1: 0
2: 6
3: 38
4: 391
903455431_903455448 18 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455448 1:23484051-23484073 GCGAAGGCGGCGGCCCCAGCCGG 0: 1
1: 0
2: 4
3: 25
4: 288
903455431_903455447 8 Left 903455431 1:23484010-23484032 CCCGCGCCAGCGCCGCCCCTCGG 0: 1
1: 0
2: 3
3: 40
4: 386
Right 903455447 1:23484041-23484063 CATCTTGGCGGCGAAGGCGGCGG 0: 1
1: 1
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903455431 Original CRISPR CCGAGGGGCGGCGCTGGCGC GGG (reversed) Exonic
900246904 1:1640554-1640576 CCGCTGGGAGGTGCTGGCGCTGG + Intronic
900258126 1:1707686-1707708 CCGCTGGGAGGTGCTGGCGCTGG + Intronic
900349482 1:2227948-2227970 GCGGGGGGCGGGGCCGGCGCGGG + Intergenic
900418686 1:2546389-2546411 CCGGGAGGCGGCGGCGGCGCAGG - Intergenic
900534108 1:3168572-3168594 GCGAGGGGCGGGGGTGGGGCGGG - Intronic
901797968 1:11691590-11691612 CCGAGGGGCAGCCCCGGGGCCGG - Exonic
902636160 1:17736329-17736351 CCGAGGGGCAGAGCTGGGACTGG + Intergenic
903069074 1:20717776-20717798 CCAAGGGGCGGGGCCAGCGCCGG + Exonic
903142228 1:21345544-21345566 CGGAGGGGCGGGGCCGCCGCGGG + Intergenic
903263163 1:22142264-22142286 CCCGGGGCTGGCGCTGGCGCTGG - Intronic
903349721 1:22710640-22710662 CCCGGGGGCAGCGCGGGCGCTGG - Intergenic
903455431 1:23484010-23484032 CCGAGGGGCGGCGCTGGCGCGGG - Exonic
904029985 1:27527896-27527918 GCAAAGGGCGGCGCTGGGGCCGG - Intergenic
904093402 1:27960198-27960220 CCTGTGGGCGGCGCTGGTGCTGG + Exonic
904256931 1:29260084-29260106 TCGAGGGGCGGGGCCGGCGACGG + Intronic
904618879 1:31763906-31763928 GCGGGGGCCGGCGCTGGCGGGGG + Exonic
904769069 1:32870914-32870936 CCGCGCGGCGGCGGTGGCGGCGG + Intronic
905580680 1:39081299-39081321 GCGGGGGGCGGCGTCGGCGCTGG + Intronic
905887936 1:41501756-41501778 CTCAGGGGCGGGGCGGGCGCTGG + Intergenic
906350158 1:45052112-45052134 GCGAGGGGGGGCGCTGAGGCTGG - Intronic
906614598 1:47225689-47225711 CCGGGGGGCGGCCCTGCCGGTGG - Exonic
910909555 1:92218717-92218739 CAGAGGGGAGGGGCAGGCGCGGG - Intronic
912409043 1:109467072-109467094 TCGTGGGGCTGCGCTGGCGGCGG + Exonic
914053822 1:144153191-144153213 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
914125324 1:144813174-144813196 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
914243896 1:145872123-145872145 CCGAGGAGCGCCGCCGGAGCGGG - Exonic
914246014 1:145886169-145886191 CCGAGGGGCGGGGCTGAGGCGGG - Intergenic
914841840 1:151254907-151254929 GCGAGAGGCGGCCCTGGCCCCGG + Intronic
915393160 1:155562451-155562473 CAGAGTGGCGGCGGTGGCGGCGG + Exonic
915722357 1:157994202-157994224 CCGAGGGGCTGGGCTGGAGTAGG - Intronic
915967842 1:160327460-160327482 CCGGGGGGCGGGGCTGGGGGGGG + Intronic
915973629 1:160370929-160370951 CTGTGGCGCGGCGCCGGCGCCGG - Exonic
916259044 1:162822492-162822514 CCGCCGGGCGGGACTGGCGCGGG + Intergenic
917345271 1:174022449-174022471 CGGAGGGGAGGGGCGGGCGCGGG + Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918001642 1:180502597-180502619 GCGCGGGGCGCGGCTGGCGCTGG + Exonic
919486815 1:198156954-198156976 GAGAGGGGCGGGGCGGGCGCCGG - Exonic
920511785 1:206557238-206557260 CGGAGGGAGGGCGCTGGCGCCGG + Intronic
920660516 1:207910834-207910856 CCCAGGTGAGGCGCTGGCCCCGG + Intronic
922116274 1:222617824-222617846 CAGAGGGGCGGCGCCCGCGAAGG - Intergenic
922496662 1:226062759-226062781 GCGAGAGGCGGCGCTGGCGTTGG - Intronic
922917659 1:229271409-229271431 GCGGGGGGCGTCGGTGGCGCGGG + Intronic
1064220918 10:13439844-13439866 CCGAGGGGCTGGGACGGCGCGGG - Intronic
1065574668 10:27105324-27105346 CCAAGGGGTGGCCCTGGCCCAGG - Intergenic
1066464214 10:35639478-35639500 CCGGGGGGCGGCGGCGGCGGGGG - Exonic
1067038019 10:42933479-42933501 CCGAGGGCAGGCCCTGGGGCGGG + Intergenic
1067142349 10:43667990-43668012 CGGAGGGGCCCCGCTTGCGCAGG + Intergenic
1067484585 10:46635686-46635708 AAGAGGGGCGGTGCTGACGCCGG - Intergenic
1067610173 10:47705960-47705982 AAGAGGGGCGGTGCTGACGCCGG + Intergenic
1070167691 10:73911076-73911098 GGGAGGGGCGGCGCCGGGGCGGG + Exonic
1070329023 10:75404943-75404965 CCGAAGGCCGGCGCGGGCCCGGG + Intergenic
1071598155 10:86942782-86942804 CCGAGTGACGGCCCTGGAGCAGG - Exonic
1073577996 10:104641259-104641281 CCGAGGTGCGGGTCCGGCGCGGG - Exonic
1074182991 10:111079111-111079133 CCAAGGCGTCGCGCTGGCGCGGG + Exonic
1074503342 10:114044973-114044995 CCGGGCGGCGGCGCGGGCGCGGG - Exonic
1075616129 10:123891858-123891880 CAGAGGCGCGGGGCGGGCGCAGG + Intronic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076035639 10:127196597-127196619 CCGCGGGGCGGAGGTGGGGCGGG + Intronic
1076391448 10:130105802-130105824 CCAAGGGGTGGGGCTTGCGCGGG + Intergenic
1076723942 10:132404795-132404817 ACGAGGGGCGGGGGTGGCTCGGG - Exonic
1077018369 11:406825-406847 CCGTGGTGCGGAGCAGGCGCGGG - Exonic
1077231729 11:1460801-1460823 CGGACGGGCGGCGCGGCCGCGGG - Exonic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077923161 11:6656003-6656025 GCGCGGCGCGGCGCTGGGGCCGG - Intergenic
1078180187 11:9004405-9004427 CCGAGCAGCGGCGCGGGCGGCGG - Intergenic
1078659837 11:13277883-13277905 CCGAGTGCGGGCGCGGGCGCGGG + Exonic
1081854077 11:46293161-46293183 CCGAGTGCCGGGGTTGGCGCAGG - Intronic
1082814600 11:57499718-57499740 CTGAGGGGCGGTGCCAGCGCCGG + Intronic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1083583319 11:63839101-63839123 CCGAGGGCCGGCGGTGGTGGCGG + Exonic
1084207954 11:67606875-67606897 CCGGTGCGCGGCGCTGGCGTCGG + Exonic
1084500361 11:69531459-69531481 CAGAGGGGACGCCCTGGCGCTGG - Intergenic
1084530805 11:69726771-69726793 CCTATGGGGAGCGCTGGCGCTGG + Intergenic
1084935498 11:72584509-72584531 CGGAGGGGCGGGGCCTGCGCCGG - Intronic
1088604473 11:111514717-111514739 CGGAGGGGCGGGGCAGGGGCGGG + Intergenic
1089174113 11:116536136-116536158 GCTAGGGGAGGGGCTGGCGCTGG + Intergenic
1089289346 11:117428478-117428500 CGGAGGGGCAGCGCTGGGGGCGG + Exonic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1092880660 12:12885528-12885550 CTGAGAGGCAGCGCTGGGGCTGG + Intergenic
1094843367 12:34351136-34351158 GCGAGGGGCGGCGAAGACGCAGG - Intergenic
1096241299 12:49961684-49961706 CCGGGGGGCGGGGGTCGCGCCGG + Intergenic
1097190397 12:57216792-57216814 GCGAGGCGCGGAGCCGGCGCTGG - Exonic
1101354700 12:103966067-103966089 GGGAGGGGCGGCGCTGGCCCCGG - Intronic
1102933871 12:116881329-116881351 GCGAGGGGCGGCCCGAGCGCGGG - Exonic
1103547519 12:121712712-121712734 GCGTGGGGCGGGGCGGGCGCCGG + Intergenic
1104289662 12:127455873-127455895 CCGAGGGGCTGGGCTGGGGCAGG + Intergenic
1104846879 12:131851351-131851373 CCTGGGGGAGGTGCTGGCGCGGG + Exonic
1105480803 13:20773747-20773769 CTGAGGGAAGGAGCTGGCGCCGG - Intronic
1108518188 13:51222280-51222302 GCGAGGGGCGGGGCGGGCGCGGG + Intergenic
1110105837 13:71674989-71675011 GCGAGAGGCGGCGCTGGCGTTGG - Intronic
1112461377 13:99606508-99606530 CCGCGGGGCGGAGCGGGTGCTGG + Intergenic
1112504930 13:99969855-99969877 CCGAGGGGCTGCGGGCGCGCTGG + Intronic
1113378929 13:109786103-109786125 GCGAGGGGCGGAGGGGGCGCGGG + Exonic
1113480352 13:110615823-110615845 CCGAGGGGCAGCCCGCGCGCGGG + Intronic
1113542014 13:111115908-111115930 GGGAGGGGCGGCGCGGGCGGCGG + Intronic
1113958036 13:114109780-114109802 ACCAGAGGCGGGGCTGGCGCAGG + Intronic
1117368276 14:55052090-55052112 CTGCGGGGCGGGGCGGGCGCGGG + Intronic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1119539251 14:75428061-75428083 GCGACGGGGGGCGCTGGCGGCGG + Intronic
1119731958 14:76956680-76956702 CCGCGGGCCGGGGCTGGCGCTGG + Intergenic
1119743258 14:77027563-77027585 CCGACGGGCGGCGGCGGCCCGGG + Exonic
1121074912 14:91060205-91060227 CGGAGGGGCGGGCCTGGGGCGGG - Intronic
1122418211 14:101560478-101560500 GCGCGGGGCGGCGCCGGCCCCGG - Intergenic
1122444756 14:101760914-101760936 CCGAGGGGAGGGGCTGGCCGAGG + Intergenic
1122910745 14:104826645-104826667 CGGAGGGGCGGGGCTGCCGGAGG + Intergenic
1122910753 14:104826662-104826684 CGGAGGGGCGGGGCTGCCGGAGG + Intergenic
1122921788 14:104883330-104883352 CCGGGGGCCGCCGCTGGCGCAGG - Exonic
1122960968 14:105093505-105093527 CCGGGGGCGGGCGCTGGAGCGGG - Intergenic
1123004437 14:105314642-105314664 CCAATCGGCGGCGCCGGCGCGGG + Exonic
1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG + Intergenic
1126116794 15:45215461-45215483 GGGAGAGGCGGCGCTGGCGTTGG - Intergenic
1129348114 15:74937595-74937617 CGCAGGGTCGGCGCTGGGGCAGG + Intronic
1129540915 15:76346541-76346563 CCGGGGGGCGGCCCTCGCCCCGG + Intergenic
1129817280 15:78565840-78565862 CAGAGGGGCGGGGCGGGAGCTGG + Intronic
1129854015 15:78811499-78811521 CCGAGGGGCGGGGCGGGGGCCGG - Intronic
1129862394 15:78872788-78872810 CCCTGGGGCGGCGCGGGCGCAGG + Intronic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1131517512 15:93089023-93089045 GGGAGGGGCTCCGCTGGCGCTGG + Intronic
1131799346 15:96053384-96053406 CAGCGGGGAGCCGCTGGCGCTGG + Intergenic
1132640181 16:974638-974660 CCTGGGGGCTGTGCTGGCGCAGG - Intronic
1132658561 16:1051577-1051599 CCGATGGGCGGCCCTGCCCCAGG + Intergenic
1132669474 16:1096733-1096755 CTGAGAGGCGGGGCTGGTGCGGG - Intergenic
1132765923 16:1534142-1534164 CCTCGGGGCGGCGCGGGCGGAGG - Exonic
1132893227 16:2214768-2214790 CCGGCGGGCGGCGATGGCGGCGG - Exonic
1133049117 16:3106651-3106673 CGGCGGGGCGGGGCTGGGGCGGG + Intergenic
1133232159 16:4371972-4371994 CCGGGAGGCGGCGGCGGCGCAGG - Exonic
1133241527 16:4416784-4416806 CCGAGGGGACGGACTGGCGCGGG + Intronic
1133379854 16:5320902-5320924 CCCAGGGGCGGCCCTGCCTCTGG + Intergenic
1135479945 16:22814189-22814211 CCGGACGGTGGCGCTGGCGCCGG - Exonic
1135517672 16:23149164-23149186 CGGAGCGGCCGCGCTGGCGGCGG - Exonic
1136362677 16:29790924-29790946 CGGAGAGGCGGCCATGGCGCAGG + Intronic
1139534450 16:67562809-67562831 CCCGGCGGCGGCGCTGGCGCCGG - Intronic
1139597881 16:67968683-67968705 CCGAGGGGCGGCCCGGGGGGCGG - Exonic
1139917692 16:70438644-70438666 CCGAGGGCTGGGGCTGGGGCTGG + Intronic
1140097057 16:71884082-71884104 CCGAGGGGCGGCGCTGCAGACGG + Exonic
1140416139 16:74774922-74774944 GCGAGGGGCGGGCCCGGCGCCGG + Intergenic
1141430656 16:83968896-83968918 CCGAGGGGCGGAGGGGGCTCCGG - Intronic
1141800399 16:86304119-86304141 GTGAGGGGCTGCGCTGGGGCTGG + Intergenic
1141959000 16:87392248-87392270 CCGAGGGGCGGGGCCAGAGCCGG - Exonic
1141995745 16:87635464-87635486 CTGAGGGGCTGTGCTGGCCCAGG + Intronic
1142248961 16:88982527-88982549 CCAGGGGGCGGCGGTGGGGCTGG - Intergenic
1142563814 17:826770-826792 CCGAGGGTTGGGGCTGGCCCTGG - Intronic
1142570224 17:868821-868843 CCCAGGGTCGGTGCTGGCACTGG - Intronic
1143063354 17:4222209-4222231 CCGCGGGGCGGCGGGGGCGGCGG - Intronic
1143078762 17:4366325-4366347 CCGAGGGCCCGGGCTGGCGCCGG + Exonic
1143099877 17:4499109-4499131 CGGAGCGGCGGCGCCGGCGCCGG + Exonic
1143503089 17:7350249-7350271 TGAAGGGGCGGGGCTGGCGCTGG + Intronic
1143503434 17:7351691-7351713 CCGAGGGGTGGGGCTGGCCCTGG + Intergenic
1143631580 17:8143210-8143232 CAGAGGGGCGGGGCTGGGGTGGG + Intronic
1144109806 17:12020902-12020924 CCGAGCGGCGGCGGCGGCTCCGG + Exonic
1145089796 17:19977532-19977554 CTCAGGGGCGGCGGTGGGGCAGG - Intronic
1145912912 17:28552671-28552693 CCCAGGGGCGGGGCCGGGGCGGG - Intronic
1146283510 17:31559749-31559771 CCGAGGGACAGCGCTGGGGGAGG - Intergenic
1146846155 17:36183200-36183222 CGGAGGGTCGGGGCTGGGGCGGG + Intronic
1146955860 17:36936117-36936139 CGGAGGCGCGGCGCCGGCGCGGG - Intergenic
1147264077 17:39224779-39224801 CCGACGGCCGGCGCTGCTGCAGG + Intronic
1147469676 17:40647820-40647842 GCGAGGGGCGGGGCGAGCGCGGG - Exonic
1147564328 17:41527449-41527471 GCCAGGGGCCGCGCTGCCGCAGG - Intronic
1148271761 17:46267014-46267036 CTGAGGCGCGGCGGCGGCGCGGG - Intergenic
1148493476 17:48037833-48037855 CCGCGGGGCGGCGCGGAGGCGGG - Intronic
1149849504 17:60026625-60026647 CGGAGGGTCGGGGCTGGGGCGGG + Intergenic
1149860664 17:60119899-60119921 CGGAGGGTCGGGGCTGGGGCGGG - Intergenic
1150488662 17:65560566-65560588 CCGAGTGGCGGCAGTGGCGGGGG - Intronic
1150488919 17:65561355-65561377 CCGAGCCGCGGCGTGGGCGCGGG - Intronic
1150692379 17:67377492-67377514 CCGAGCGGCGGCGGCGGCGGCGG + Intronic
1151453540 17:74213465-74213487 CGGCGGGGCGGGGCGGGCGCGGG + Intergenic
1151660772 17:75516844-75516866 CCGAGCGGCTGCGCCGGTGCCGG + Exonic
1151703536 17:75755399-75755421 CCAGGGGGCGGGGCTGGGGCTGG + Intronic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1151807242 17:76413657-76413679 CCGAGAGTCGGCGCAGGTGCTGG - Intronic
1151966335 17:77433614-77433636 CAGAGGGGTGGGGCTGGAGCGGG + Intronic
1152049225 17:77959215-77959237 CCGCGGGGCTCCGGTGGCGCGGG - Intergenic
1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG + Intronic
1152567803 17:81107959-81107981 CCCAGGTGTGGCGCTGGGGCTGG - Intronic
1152573484 17:81130484-81130506 CCGAGGGGTGGGGCTGACCCAGG - Intronic
1152870635 17:82751578-82751600 CCGGGGGGCGGGGCGGGGGCGGG - Intergenic
1152925266 17:83084750-83084772 CCGAAGGGCGGAGATGGCGCCGG + Intronic
1155508168 18:26550656-26550678 CCGAGGTGCGGCGCGGGAGGTGG + Intronic
1155508234 18:26550964-26550986 CCCGGGGGCCGCGCTGGCTCCGG + Intronic
1158312176 18:56170826-56170848 CCTGGGGGCGGCACTGGTGCTGG - Intergenic
1158718244 18:59899784-59899806 CCGCGGGTCGGCGCCGCCGCGGG + Intergenic
1160204471 18:76822186-76822208 CGGAGGCGCGGGGCTGGCCCAGG + Exonic
1160222654 18:76988653-76988675 CCGAGGGGGGCCGCAGGCTCAGG + Intronic
1160689841 19:456430-456452 GCGAGGGACGGCGGTGGCCCAGG - Intronic
1160765712 19:806631-806653 GCGAGGGGCGGCGCTGCTCCGGG - Intronic
1160784014 19:891468-891490 CGGAGGGTCTGCGCTGGCCCAGG + Intronic
1160853549 19:1206054-1206076 CCGCGGGGCGGCGCGGCGGCGGG - Intronic
1160860948 19:1237051-1237073 CAGGGGGTCGGGGCTGGCGCCGG + Intronic
1160861318 19:1238222-1238244 CCGAGGTGCGCCGCGTGCGCAGG + Intergenic
1160921999 19:1525374-1525396 CCGTGTGGCGGGGCTGGGGCCGG + Exonic
1161022139 19:2015536-2015558 CCCAGGGGCGGCGGCGGCGGCGG + Exonic
1161313345 19:3606908-3606930 CCGAGGGGCGTGGCCAGCGCAGG - Intergenic
1161393391 19:4032624-4032646 CCTTGGGGCGGTGCTGGGGCTGG + Intronic
1161543791 19:4867760-4867782 GAGAGGGGCGGGCCTGGCGCGGG - Exonic
1161688949 19:5719822-5719844 GCGGGGGGCAGCGCGGGCGCCGG - Exonic
1161979568 19:7623562-7623584 CTGAGGGGCGGGGCTCGGGCAGG + Intronic
1161979613 19:7623733-7623755 CCCGGGGGCGGCCCTGGTGCAGG + Exonic
1162079407 19:8209447-8209469 CCGAGGGCCGGCGGCGGGGCTGG - Exonic
1162373539 19:10292425-10292447 CCGAGGGGCGGGGCAGGTGGGGG + Intronic
1162486041 19:10961126-10961148 CGGAGGGGCGGGGGAGGCGCCGG + Exonic
1162728074 19:12701712-12701734 CTGAGGGCAGGCGCGGGCGCTGG - Intronic
1162905002 19:13818067-13818089 GCTAGGGGCGGGGCTGGGGCGGG - Intronic
1163651795 19:18522087-18522109 CGGCGTGGCGGCGCTGGAGCCGG - Exonic
1163720511 19:18896205-18896227 CAGCGGGGCGGAGCTTGCGCCGG - Intronic
1163761186 19:19137684-19137706 CCGAGGAGGGGCGCTGGAGATGG - Intronic
1165318530 19:35072330-35072352 CCGAGGGGCAGGGCTGGCGCTGG + Intergenic
1165325085 19:35109819-35109841 CAGGGGTGTGGCGCTGGCGCAGG + Intergenic
1165349388 19:35268097-35268119 CCGGCCGGCGGCGCGGGCGCGGG - Intergenic
1165427874 19:35755739-35755761 GCGTGGGGCGGGGCTGGAGCGGG - Intronic
1165808451 19:38596246-38596268 CGGAGGGGCGGAGCTGGAGGCGG - Intronic
1166694653 19:44845949-44845971 GCGAGGGGCGGGGCTGGTGGAGG + Intergenic
1166702717 19:44891461-44891483 ACGAGGGCCGGCGCAGGCGGCGG - Exonic
1167074299 19:47239663-47239685 AGGAGGGGGGGCGCGGGCGCAGG - Intergenic
1167129220 19:47573308-47573330 CCGAGGGGCGGGGCTTGCCGCGG + Intergenic
1167284099 19:48589117-48589139 CCGAGAGGCGGCGCTGGCCGGGG + Intronic
1167738682 19:51311713-51311735 CCGGGGGGCGGCGGGGGCGGGGG - Intergenic
1168001577 19:53450680-53450702 CCGAGAGGCGGAGCTGGCTGCGG - Intronic
1168063811 19:53908527-53908549 CCGAGGGTCGGAGCGGGGGCTGG - Intergenic
1168078172 19:53991757-53991779 CCGAGGGGGGGCCCTGGCCTGGG + Intergenic
1168710914 19:58499454-58499476 TCTCGGGGCGGGGCTGGCGCGGG - Intronic
1202693298 1_KI270712v1_random:105849-105871 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
927929153 2:27033073-27033095 CCTGGGGTCGGCGCCGGCGCCGG + Exonic
928904377 2:36355487-36355509 CCGAGCTGCGGCTCTGGCCCCGG - Intergenic
929033875 2:37672524-37672546 CCGGGCGGCGGCGCTGGCGGTGG - Intronic
932556029 2:72825684-72825706 CCGAAGGGAGGGGCCGGCGCCGG + Intronic
933741716 2:85539094-85539116 CCGAGGGGCGGGGCCCGAGCCGG + Intergenic
933953270 2:87348710-87348732 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934079054 2:88452279-88452301 CCGGGGGGCGGCGGCGGCGGCGG + Exonic
934237501 2:90245055-90245077 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934275689 2:91571610-91571632 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
934503294 2:94874830-94874852 CCGAGGCCAGGCGCTCGCGCTGG - Exonic
934539111 2:95159741-95159763 TCGGGAGGCGGGGCTGGCGCGGG - Intronic
934954748 2:98608359-98608381 CCGCAGGGCGGCGCGTGCGCGGG - Exonic
935204724 2:100887796-100887818 CCGAGGGCCTGGGCTGGTGCCGG + Intronic
935592247 2:104854292-104854314 CCGACGGCGGGCGCTGGCGCTGG - Intergenic
936126698 2:109794579-109794601 CCGGGGGGCGGCGGCGGCGGCGG + Intronic
936433182 2:112482009-112482031 CCCGGGGGCGGCGGCGGCGCAGG - Intergenic
937134941 2:119544459-119544481 GCGGGCGCCGGCGCTGGCGCCGG + Exonic
937956259 2:127423200-127423222 CGGCGGGGCGGGGCTGGGGCCGG + Intronic
938487359 2:131724212-131724234 ACGAGGGCCGGCGCAGGCGGCGG + Intronic
940639639 2:156333027-156333049 CCGAGCCGCTGCGCGGGCGCAGG - Intronic
942319040 2:174719832-174719854 GCGAGAGGCGGCGCTGGCGTTGG - Intergenic
946322523 2:218961985-218962007 CCGAGGTGCTGAGCTGGGGCGGG + Exonic
946386676 2:219387988-219388010 CCGAGGGGCGGGGCTGACCGAGG - Exonic
946865741 2:224039538-224039560 CCGAGGTGCGGCGCCAGCCCGGG + Intergenic
947119536 2:226800175-226800197 CCGGGGGGAGGCGGGGGCGCCGG + Intergenic
947800641 2:232927319-232927341 GGGAGGGGCGGCGCTGGCTGCGG - Intronic
949020549 2:241738708-241738730 CCGAGGGGCGGCCCTGCAGCAGG - Intronic
1168801393 20:645636-645658 CAGAGGGACGGCCCTGCCGCGGG + Intergenic
1169059745 20:2652760-2652782 CCCAGGGCAGGCGCAGGCGCAGG - Intronic
1169673874 20:8132768-8132790 CCGAGTCGGGGCGCTGGCTCGGG + Intronic
1171876840 20:30585435-30585457 CCCAGCGCCGGCGCAGGCGCAGG + Intergenic
1172474394 20:35226536-35226558 CCGCGGAGCGGCGCTGGGGAGGG - Intergenic
1174571919 20:51508273-51508295 GCCAGGGTCGGGGCTGGCGCAGG - Intronic
1174874024 20:54208324-54208346 CCGAGGCGGGGCGCCGGGGCTGG + Intronic
1175374438 20:58514753-58514775 GCAAGGGGAGGCGCGGGCGCAGG + Exonic
1175847369 20:62065824-62065846 CCGAGCGGCGGCGGCGGCGGCGG - Intergenic
1175992050 20:62794507-62794529 CCGCGGGGCGGGGCCGGGGCCGG - Intergenic
1176135642 20:63520944-63520966 GCGAGGGGCGGGGCTGGGCCGGG + Intronic
1176274455 20:64255880-64255902 CCGAGGGGCGGCGGCGGCGGCGG - Intronic
1178673971 21:34615179-34615201 GTGACGGGCGGGGCTGGCGCTGG - Intergenic
1178948489 21:36966893-36966915 GCGAGGGGCAGCGCTGGGGCGGG + Intronic
1179998558 21:44985010-44985032 CCGAGGGGGCGGGCTGGAGCAGG - Intergenic
1180095892 21:45555223-45555245 CCGGGGGGCGGCGCAGGGGGCGG + Intergenic
1181083624 22:20429361-20429383 CGGAGGGGCGGGGCCGGGGCGGG + Intronic
1181902819 22:26169773-26169795 CCGAGGGGCGGGGCGGGCAGGGG + Intronic
1183740692 22:39666968-39666990 CAAAGGGGCGGAGCTGGCACTGG - Intronic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184439168 22:44498173-44498195 CCAAGCGACGGCGCTGGCGATGG + Exonic
1184594785 22:45507143-45507165 GCGAGGAGCGGGGCTGGGGCTGG + Intronic
1185343064 22:50300093-50300115 CCGAGGGGCGGACGGGGCGCCGG - Intronic
949896011 3:8768125-8768147 CGGCGGCGCGGCGCTGGCGTTGG + Exonic
949929117 3:9064425-9064447 CAGAGCTGCGGCGCTGGGGCCGG + Exonic
950316308 3:12004651-12004673 CCGGGGGGCGGCGGCGGCGGCGG - Exonic
950487807 3:13283115-13283137 CCCGGGGGCGGCGCCGGCGGAGG - Intergenic
950821878 3:15768652-15768674 GCGGGGGGCGGCGGTGGGGCAGG + Intronic
953897408 3:46812617-46812639 CCGAGGGGCGGGGCCTGGGCGGG + Intergenic
954186331 3:48919426-48919448 CCTAGGGGCGCCGCGGGCTCCGG - Intronic
954277944 3:49554621-49554643 CTGGAGGGCGGCGCTGGCGACGG + Exonic
954618601 3:51983278-51983300 TCGCGGGGCGGCGCTGGCCGCGG + Exonic
954652798 3:52175622-52175644 CCGAGGGGCACCCCTGGTGCTGG - Intergenic
954735794 3:52705788-52705810 CCGCGGGGCAGCCCTGCCGCCGG + Exonic
954764012 3:52897676-52897698 CCGAGGGGCGGGGCTCCGGCCGG + Intergenic
954779001 3:53045749-53045771 TGGAGGGGCGGCGGCGGCGCCGG - Intronic
963503904 3:146161221-146161243 CCGAGGGGAGGCGACGGGGCGGG + Intronic
964819668 3:160755885-160755907 CGGAGGGACCGCGCGGGCGCCGG + Intronic
967762493 3:193241328-193241350 CAGCGTGGCGGCGCTGGTGCTGG + Exonic
968084217 3:195867398-195867420 CAGAGGGGCTGCCCTGGCGATGG - Exonic
968093041 3:195909767-195909789 CCCCGGGGCGGCGCAGGCGCAGG - Intronic
968199511 3:196740117-196740139 CCGAGGCGCCTCGCTGGGGCGGG + Exonic
968293453 3:197555879-197555901 CCGAGGGGGGGCGCTGCCGCAGG + Exonic
968341575 3:197960178-197960200 GCGAGGGGCGGGGCCGGCGCGGG + Intronic
969585078 4:8087000-8087022 CCGAGGTGCAGCACTGGCCCTGG - Intronic
969652672 4:8477272-8477294 CCACGGGGCGGCGCTGCCACGGG + Intronic
969715741 4:8867404-8867426 CCGGGGGGTGGCCGTGGCGCCGG + Exonic
970509586 4:16768004-16768026 CCGAGGGGCAGCCCTGGCACCGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972533066 4:39977589-39977611 CCCGGGAGCGGCGCTGGGGCTGG + Exonic
973292440 4:48483680-48483702 CCCAGGGCCGGGGCCGGCGCTGG - Exonic
975986050 4:80202423-80202445 GCGGAGGGCGGCGGTGGCGCTGG + Exonic
977932167 4:102761000-102761022 CCTAGGGGCGGGGCCGGGGCGGG - Intergenic
978529948 4:109703096-109703118 CCGAGTAGCGACGCCGGCGCCGG - Intronic
978781866 4:112564912-112564934 GCGACAGGCGGCGCTGGCGTTGG - Intronic
979785575 4:124712431-124712453 CCGGGGGGCGGCGGCGGCGGTGG - Intronic
979785682 4:124712797-124712819 CCGAGCGGCGGGGCGGGGGCGGG - Intergenic
980930173 4:139177142-139177164 CGGTGGGGCGGCGCGGGCGGGGG - Exonic
980986348 4:139698608-139698630 GCGAGAGGCGGCGCTGGCGTTGG + Intronic
981531950 4:145761919-145761941 CCGAGGGGCCGGGCGGGGGCTGG - Intronic
982584768 4:157222428-157222450 GCGAGGAGCGGGGCTGACGCAGG + Intronic
984908283 4:184649479-184649501 GCGGGAGGCGGGGCTGGCGCTGG - Intronic
985437059 4:189940679-189940701 CCGAGGCGCGGTGCTGACGGTGG - Intergenic
985542968 5:495381-495403 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985542979 5:495416-495438 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985542990 5:495451-495473 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543001 5:495486-495508 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543012 5:495521-495543 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543023 5:495556-495578 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543034 5:495591-495613 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543045 5:495626-495648 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543056 5:495661-495683 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543067 5:495696-495718 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543078 5:495731-495753 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543089 5:495766-495788 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543100 5:495801-495823 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543111 5:495836-495858 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543122 5:495871-495893 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543133 5:495906-495928 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985543144 5:495941-495963 GGGAGGGTCGGCGATGGCGCGGG - Intronic
985587836 5:750159-750181 CCGAGGGGCTTCTCTGGCCCAGG + Intronic
985602503 5:842626-842648 CCGAGGGGCTTCTCTGGCCCAGG + Intronic
986451443 5:7869343-7869365 CCGGGGGTCGCCGCGGGCGCGGG + Intronic
987015102 5:13810173-13810195 CGCGGGGGCGGCGCTGGAGCTGG - Exonic
989576459 5:42992664-42992686 CCGGGCGGCGGCGGCGGCGCTGG + Intergenic
992939729 5:81750724-81750746 TTGAGGGGCGGCGGTGGTGCTGG - Intronic
995853706 5:116572936-116572958 CGGAGGGGCGGCGAGGGAGCGGG + Intronic
996738306 5:126777066-126777088 GCGGGGGGCGGAGGTGGCGCGGG - Intronic
1000233035 5:159332967-159332989 CCGAGGGGCAGAGATGGCGTAGG - Intergenic
1002316561 5:178348046-178348068 CCGAGGGGCACTGCTGGGGCTGG - Intronic
1002926768 6:1609687-1609709 CCGGGCGCCGGCGCGGGCGCAGG + Intergenic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003608881 6:7590556-7590578 CCGAGGGGCGCCGGGGGCCCTGG + Intronic
1005267379 6:24126246-24126268 CGGAGCGGCGGCGGTGGCGACGG + Exonic
1006166608 6:32069070-32069092 CCGAGGTGGGGCTCAGGCGCTGG + Intronic
1006599253 6:35214573-35214595 CCGAGGGGCAGGGCAGGTGCTGG + Intronic
1007665325 6:43510036-43510058 AAGTGGGGCGGCGCTGGGGCGGG + Exonic
1008545174 6:52577268-52577290 GCCGGGCGCGGCGCTGGCGCGGG - Intergenic
1009905608 6:69867241-69867263 CTGGGGGGCGGCGCGGGCGCGGG + Intronic
1011516981 6:88166029-88166051 GCGGGAGGCGGCGCCGGCGCCGG + Exonic
1011607333 6:89117984-89118006 CCGAGGGGTGGGGGTCGCGCCGG - Exonic
1013033691 6:106360612-106360634 CCCAGGTGAGGCGCTCGCGCCGG - Intergenic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1016433193 6:144008578-144008600 CCCAGGTACAGCGCTGGCGCAGG + Intronic
1017103125 6:150865846-150865868 GCGGGCGGCGGAGCTGGCGCAGG - Exonic
1017206461 6:151808368-151808390 CCGACGGGCGGCGCGGGCGCGGG - Intronic
1019282478 7:207463-207485 GCGAGGGGCAGGGCTGGCCCCGG - Intronic
1019387703 7:767725-767747 CTGCGAGGCGGAGCTGGCGCTGG + Intronic
1019437153 7:1028179-1028201 CCGCGGGGCGGGGCTGGGGCAGG + Intronic
1019563129 7:1667682-1667704 GCGGGGGGCGGGGCCGGCGCTGG - Intergenic
1019582115 7:1769899-1769921 CCCAGGGTGGGCCCTGGCGCTGG - Intergenic
1019618871 7:1979848-1979870 TCAGGGGGCGGCGCTGGAGCCGG - Intronic
1019795230 7:3043778-3043800 CCGAGGGGCGCCGCCCGCCCAGG + Exonic
1020082733 7:5295537-5295559 CAGAGGGGCAGCACTGGCCCCGG + Intronic
1020130165 7:5555206-5555228 CCGAGGGGCGGGGTGGGGGCCGG - Intronic
1020238467 7:6374468-6374490 GGGAGCGGCGGCGCCGGCGCGGG + Intergenic
1023703057 7:42911769-42911791 CTGAGCCGCGGCGCTGGCGGTGG - Intronic
1023984963 7:45088967-45088989 CCGAGGGGCGGTGGCCGCGCAGG - Intergenic
1024089107 7:45921062-45921084 CCGCGGGCCGCCGGTGGCGCGGG - Exonic
1025087324 7:56034016-56034038 CCGAGCGTCGGAGCCGGCGCTGG - Exonic
1027774015 7:82443311-82443333 CCGAGGGGCGCCGCGGGAGTTGG - Intronic
1027978364 7:85186447-85186469 CCCAGGGGCCGCGCTGAAGCTGG + Intronic
1029630649 7:101748100-101748122 CCGAGGGGCCGCGCTGGGCGGGG + Intergenic
1030727197 7:112939761-112939783 CTGAGGGGCGGCGGCGGCGGCGG - Exonic
1031010904 7:116525101-116525123 CCGTGGGGGGGCGCCGGCTCGGG + Intronic
1031997317 7:128241170-128241192 CTGAGGGGCGGGGCGGGAGCTGG + Intergenic
1034223059 7:149460356-149460378 CCGAGCGGCGGCGTCGGAGCTGG + Intronic
1034223088 7:149460453-149460475 CAGAGGGGCGGCGCGCGGGCCGG - Intronic
1034440516 7:151083446-151083468 CCGAGGGGCCGCGATGGAGCTGG - Intronic
1034509068 7:151519731-151519753 AAGAGGGGCGGTGCTGACGCCGG - Exonic
1034680689 7:152925478-152925500 CCGAGGGGCCGGGCGCGCGCGGG + Intergenic
1034978034 7:155459115-155459137 CTGGGGGGCGGTGCTGGCGCGGG + Intronic
1035512966 8:206383-206405 GTGAGGCGCGGCGCAGGCGCAGG + Intergenic
1035848907 8:2894231-2894253 CCGAGGGGCAGCGCTGACCCTGG + Intergenic
1036434806 8:8723437-8723459 CCGAGGGGCGCGGCAGGGGCCGG - Intergenic
1036578827 8:10054400-10054422 CCGGGGGGCGGCAGGGGCGCGGG - Exonic
1036910724 8:12755240-12755262 CCGCGGGGAGCTGCTGGCGCTGG - Exonic
1036950265 8:13133337-13133359 CCGAGGGGCGGGGCCAGAGCGGG + Intronic
1037855395 8:22367573-22367595 CCGTGGTGCCGCGCTGGCGAGGG + Intronic
1037855440 8:22367751-22367773 CCGAGGGGCGGCTCTTGGGGCGG + Intronic
1037901770 8:22692975-22692997 GCGAGCGGCGGCGGTGGCGGCGG - Exonic
1038632856 8:29262704-29262726 CGCAGGGGCGGGGCGGGCGCAGG + Intronic
1041108007 8:54459713-54459735 CCGGGGGGTGGTGCTGGTGCTGG - Exonic
1041552671 8:59119229-59119251 CCAAGAGGCGGCGGTGGAGCAGG - Intergenic
1044685605 8:94823225-94823247 CGAAGGCGCGGCGGTGGCGCGGG + Intronic
1045737922 8:105318458-105318480 CGGAGCGGCGGCGGCGGCGCCGG + Intronic
1046584974 8:116140122-116140144 CCCAGGGGGGGCTCTGGGGCAGG + Intergenic
1047192039 8:122687062-122687084 CTGAGGGGCGGCAGTGGGGCTGG - Intergenic
1049203281 8:141351998-141352020 CCGAGGGGAGGGGCTGCGGCTGG - Intergenic
1049615026 8:143572324-143572346 CAGGGGGGCGGTGCTGGCCCCGG - Intronic
1049621236 8:143599219-143599241 CAGCGGGGAGCCGCTGGCGCAGG - Exonic
1049694355 8:143976306-143976328 CGGAGGGGGTGGGCTGGCGCGGG + Intronic
1049989231 9:976569-976591 CCCAGGGGCGGGGGTGGCGGTGG + Intergenic
1056935392 9:90912073-90912095 CAGAGGGACGGCGCTGGAGCGGG - Intergenic
1056935850 9:90914335-90914357 CAGAGGGACGGCACTGGAGCGGG - Intergenic
1057110893 9:92469761-92469783 CTGAGGGGAGGCGGTGGCGGGGG + Intronic
1058439090 9:104991224-104991246 CCGGCGGGCGGGGCCGGCGCTGG - Intergenic
1059452787 9:114381256-114381278 CCCAGCGGCGGCGCTGGGCCTGG - Exonic
1061007212 9:127935057-127935079 CCCAGGGTCGGGGCTGGAGCGGG - Intergenic
1061108905 9:128552904-128552926 CCGAGGCTCGGCGCCGCCGCTGG + Intronic
1061800680 9:133112042-133112064 ACAAGGGGCAGCGCTGGCTCGGG - Exonic
1062216305 9:135391531-135391553 TGGAGGAGCGGAGCTGGCGCAGG - Intergenic
1062403011 9:136380628-136380650 CTGAGGGGCTGCGGTGGAGCGGG + Intronic
1062732885 9:138119468-138119490 CCGAGGGACAGGGCTGGCACGGG - Intronic
1187154619 X:16712011-16712033 CCGGGTGCGGGCGCTGGCGCGGG + Exonic
1187900905 X:24025748-24025770 ACGCGGGGCGCCGCGGGCGCGGG - Intronic
1190108036 X:47573084-47573106 CAGAGGGGCAGGGCTGGGGCTGG - Intronic
1190692153 X:52920857-52920879 CCGTGGGGCGTTGCTGGCGTAGG - Intergenic
1191671832 X:63755248-63755270 CCCAGGGGCGGGACTTGCGCTGG + Intronic
1192630953 X:72777481-72777503 GCGGGGGGCGGCGGGGGCGCGGG - Intronic
1192650756 X:72943320-72943342 GCGGGGGGCGGCGGGGGCGCGGG + Intronic
1196454109 X:115882707-115882729 CCGGGGGGCAGGGCTGGGGCTGG + Intergenic
1196734962 X:118975128-118975150 GCAAGGCGAGGCGCTGGCGCCGG + Exonic
1196763639 X:119223201-119223223 GCGAGGCGGGGCTCTGGCGCGGG + Intergenic
1197179027 X:123514394-123514416 GCGAGAGGCGGCGCTGGCGTTGG - Intergenic
1197203041 X:123765250-123765272 CCGAGTGGCGGCGGCGGCGGCGG - Intergenic
1197806370 X:130402124-130402146 CCGAGGGGCGGGAGCGGCGCGGG + Intronic
1198388094 X:136147545-136147567 CCGAGGCGCGGCGGTGGCGGCGG - Exonic
1200093867 X:153648204-153648226 GCGGGGGCCGGCGCCGGCGCGGG + Exonic
1200418401 Y:2936093-2936115 CCGAAAGGTGGCGCTGCCGCAGG - Intronic