ID: 903461205

View in Genome Browser
Species Human (GRCh38)
Location 1:23522077-23522099
Sequence GTCACAGCTCAGGGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 2, 2: 8, 3: 55, 4: 475}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903461187_903461205 26 Left 903461187 1:23522028-23522050 CCGAGTCTTCTCCCCGGGGGATT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG 0: 1
1: 2
2: 8
3: 55
4: 475
903461192_903461205 15 Left 903461192 1:23522039-23522061 CCCCGGGGGATTTGGGGGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 149
Right 903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG 0: 1
1: 2
2: 8
3: 55
4: 475
903461193_903461205 14 Left 903461193 1:23522040-23522062 CCCGGGGGATTTGGGGGCTGAAG 0: 1
1: 0
2: 5
3: 37
4: 246
Right 903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG 0: 1
1: 2
2: 8
3: 55
4: 475
903461194_903461205 13 Left 903461194 1:23522041-23522063 CCGGGGGATTTGGGGGCTGAAGA 0: 1
1: 0
2: 1
3: 26
4: 274
Right 903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG 0: 1
1: 2
2: 8
3: 55
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903461205 Original CRISPR GTCACAGCTCAGGGAGGGGA GGG Intronic
900104085 1:974807-974829 GTCACAGGTCAGGGAGGTCCTGG + Exonic
900310348 1:2030427-2030449 GTCAGAGCTCAGGGAGGCCGAGG - Exonic
900404410 1:2486180-2486202 GGCAAAGGTCAGGGAGGGAAGGG - Intronic
900495429 1:2973931-2973953 GTCACAGCCAGGGCAGGGGATGG + Intergenic
900994026 1:6110585-6110607 GAGGCAGCTCAGGGAGGGGGAGG + Intronic
901455532 1:9360895-9360917 GTGGCAGCACAGGGAGAGGAAGG - Intronic
901492387 1:9603115-9603137 GTGACAGGTCAGGGAGGGAAAGG - Intronic
901869676 1:12130582-12130604 ATCACAGGCCAGAGAGGGGAGGG + Intronic
901974490 1:12933289-12933311 CTCACAGCTCAGGCTGGGGGAGG + Intronic
902010682 1:13268478-13268500 CTCACAGCTCAGGCTGGGGGAGG - Intergenic
902379391 1:16045518-16045540 GTCACGGCACAGGGTGGGGCAGG - Intronic
902732281 1:18377328-18377350 TTCAGAGCTCAGGGAAGGAATGG - Intronic
903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG + Intronic
903696430 1:25210796-25210818 CCCAGACCTCAGGGAGGGGAGGG - Intergenic
904236487 1:29120790-29120812 GTCACATCCCAGGCTGGGGATGG - Exonic
904566479 1:31431538-31431560 GTGCCAGGTCGGGGAGGGGAAGG - Intronic
905222967 1:36461536-36461558 GTCTCATCACAGGGAGGGCAAGG + Intronic
905281273 1:36850839-36850861 GTGGCAGCACAAGGAGGGGATGG + Intronic
905453797 1:38073871-38073893 GGCACAGCTCAGGGCTGAGAAGG + Intergenic
905803562 1:40861127-40861149 CTCCCACCTCAAGGAGGGGAAGG - Exonic
906061224 1:42949987-42950009 GTCTCAGCTCAGAGTGGGCAAGG - Intronic
906490950 1:46268109-46268131 CTCAAAGCACTGGGAGGGGAGGG - Intronic
907589430 1:55652085-55652107 GTCATAGCTCAGGCTGGGGTTGG + Intergenic
909122227 1:71617763-71617785 GCCACAGCTCTGTGAGGAGATGG + Intronic
912812133 1:112802567-112802589 GGAACAGCCCAGGGAGGGGCGGG + Intergenic
913586440 1:120279387-120279409 GTCAGTGATCAGGGTGGGGAAGG + Intergenic
913621746 1:120618983-120619005 GTCAGTGATCAGGGTGGGGAAGG - Intergenic
914568450 1:148891249-148891271 GTCAGTGATCAGGGTGGGGAAGG + Intronic
914604375 1:149239002-149239024 GTCAGTGATCAGGGTGGGGAAGG - Intergenic
914851108 1:151314902-151314924 GTCTCAGGTCAGGGTGTGGAGGG + Intronic
915325820 1:155080724-155080746 GTGAAAGCTCAGGGAGCGGGTGG + Intronic
915339317 1:155167571-155167593 GACACAGCCTAGGGCGGGGAGGG - Intergenic
915364422 1:155306419-155306441 GTCTCTGCTCAGTGTGGGGATGG + Intergenic
915394460 1:155572235-155572257 GTCACAGCTGAGGGAGGGAAGGG - Intergenic
916051363 1:161038959-161038981 GTCTCAGCTCTGGGAGGGAACGG - Exonic
916268911 1:162919426-162919448 CCCACAGCCCAGGAAGGGGATGG + Intergenic
918610657 1:186486887-186486909 GTCACAACTGGGGGTGGGGAGGG - Intergenic
919407336 1:197201347-197201369 GGCGGAGCTCTGGGAGGGGAAGG - Intergenic
919569203 1:199224470-199224492 TTCACAGCTCAGAGTGGGAAAGG + Intergenic
919943032 1:202301427-202301449 GCCACAGTTCAGGGAGGTGGAGG - Intronic
920344153 1:205295101-205295123 ATCACAGCCCAGGGAGGGCACGG - Intergenic
920357591 1:205386169-205386191 GTCCCAGCGCAGGGTGGGGTGGG + Intronic
920960289 1:210657450-210657472 GCCACTGCTCTGGAAGGGGAAGG - Intronic
921489690 1:215759909-215759931 ATCACAGTTCATGGGGGGGATGG - Intronic
922984578 1:229856399-229856421 GGCACAGCTCTGGGGAGGGAGGG + Intergenic
924776061 1:247114994-247115016 GCCACAGCCCAGTGCGGGGAGGG + Intergenic
1062855320 10:777271-777293 GTCACAGCACACGCTGGGGAAGG - Intergenic
1062855427 10:777567-777589 GTCACAGCCCACGCCGGGGAAGG - Intergenic
1063007666 10:1989304-1989326 GTCACAGCCCTGGGACGGGAAGG + Intergenic
1063517571 10:6712125-6712147 ATTACAGCGCAGGGAGGGGAGGG + Intergenic
1064269107 10:13849252-13849274 GTCACAGCCAAGGGCTGGGAAGG - Intronic
1065385414 10:25128797-25128819 GTGGTAGTTCAGGGAGGGGAGGG - Intergenic
1065850088 10:29780602-29780624 GCCACAGCACAGAGAGGTGAGGG - Intergenic
1067232818 10:44424165-44424187 GTCACATCTTAGTGAGGAGATGG + Intergenic
1067317287 10:45180622-45180644 GCCCCAGCTCAGGCAGGGCACGG - Intergenic
1071191769 10:83109237-83109259 GTGATTGCTCAGGGTGGGGAAGG - Intergenic
1072327318 10:94311268-94311290 GCCAGACCTCAAGGAGGGGAGGG - Intronic
1072687901 10:97549704-97549726 GCCCCAGCTCAGGGAGGGAAAGG - Intronic
1073042330 10:100615994-100616016 GTGCCAGGTCAGGGAGGGGCTGG - Intergenic
1073426228 10:103457307-103457329 GGCACAGGTTAGGGAGGAGAGGG + Intronic
1073607795 10:104913884-104913906 GTCCCAGCTCTGGGAGGCTAAGG - Intronic
1074116857 10:110462741-110462763 GACACAGCTCAGGGAGGTCTTGG + Intergenic
1075517350 10:123119438-123119460 GTCACGGGGCAGGGAGGGAAGGG - Intergenic
1075521276 10:123145118-123145140 GTCACACCGCAAGGACGGGAGGG - Intergenic
1075872668 10:125782128-125782150 GTCCCAGCTCAGGAAGTGGGAGG - Intergenic
1076107647 10:127835915-127835937 GTCACAGCTGGGGGCAGGGAAGG + Intergenic
1076560755 10:131361799-131361821 GACAGAGATCAGGGAGGGCAGGG - Intergenic
1076869856 10:133187952-133187974 GACAGAGCTCATGGAGGGGAAGG - Intronic
1077110589 11:860439-860461 TGCACTGCTCAGGGAGGGGCAGG + Intronic
1077114310 11:876375-876397 GTCGGGGCTCAGGGAGGGGCTGG + Intronic
1077183024 11:1224825-1224847 GTCAGGGCTCAGCGAGGGGCCGG - Intronic
1077287206 11:1772961-1772983 GGCACAGGTGGGGGAGGGGAAGG + Intergenic
1077287230 11:1773023-1773045 GGCACGGGTCGGGGAGGGGAAGG + Intergenic
1077297664 11:1833695-1833717 GCTGCAGCTCAAGGAGGGGAGGG - Intronic
1077502275 11:2914783-2914805 GTCACAGCTCAGGGTCTGGCTGG - Intronic
1077505327 11:2927525-2927547 GTCTGGGCTCAGGGCGGGGAGGG - Intergenic
1077537215 11:3130162-3130184 ATCATGGCTCAGGGAGTGGAAGG + Intronic
1078607076 11:12786122-12786144 GTCACAGCACAGGGTGGGAGGGG + Intronic
1079313198 11:19384818-19384840 GTCCCAGCTCAGGGATAGCAAGG - Intronic
1079391029 11:20022305-20022327 GTCCCAGCTCTGGGATGGGAAGG - Intronic
1079888230 11:26016254-26016276 GTCACATTTCAGGGTGAGGAAGG - Intergenic
1080876760 11:36281651-36281673 GGCACTGCTTAGGCAGGGGAAGG - Intronic
1081694175 11:45098156-45098178 ACCACAGCTGATGGAGGGGATGG + Intronic
1082764046 11:57152468-57152490 GTCACAGCTAAGGCAAGGAAAGG + Intergenic
1083329513 11:61891049-61891071 GTCAAAGGTCAGCGAGGGGAGGG + Intronic
1083749310 11:64752683-64752705 ATCAGAGCTCAAGGACGGGAGGG - Intronic
1084067019 11:66710542-66710564 AGCACAGCTCAGGGAAGGGTGGG + Intronic
1084793224 11:71488295-71488317 GAGAGAGCTCAAGGAGGGGAAGG + Intronic
1085331711 11:75657430-75657452 GCCACAACTCAGGGTAGGGAGGG + Intronic
1085455375 11:76662451-76662473 ATCTAGGCTCAGGGAGGGGAAGG + Intronic
1085692164 11:78672755-78672777 ACCAAAGCTCAGGGAGGTGAAGG + Intronic
1086015915 11:82167327-82167349 GTTTCAGCACAGGGAGGGGAAGG + Intergenic
1088656489 11:112004701-112004723 CCTACAGCTGAGGGAGGGGAAGG + Intronic
1088922755 11:114273221-114273243 GTTACAGCTCAGGGATAAGAGGG + Intronic
1089162892 11:116453020-116453042 TGCAAAACTCAGGGAGGGGAAGG + Intergenic
1089278100 11:117353280-117353302 GTAACATGTCAGGGAGGGGAGGG - Intronic
1089568477 11:119386105-119386127 GACACAGCTGAGGGAGGAAATGG - Intergenic
1089582147 11:119488222-119488244 ATCAAAGCTCAGGGAGGCCATGG - Intergenic
1091058959 11:132444114-132444136 GTATCAGGCCAGGGAGGGGATGG + Intronic
1091360266 11:134973811-134973833 GACACAACTCAGGGAGGTGTAGG - Intergenic
1091664545 12:2409881-2409903 CTCTCAGGTCAGGGAGGAGAGGG + Intronic
1092070393 12:5627021-5627043 GTCACAGCTCATGTCTGGGAAGG + Intronic
1092071124 12:5632103-5632125 CACACAGCTCAGGGAGCAGAAGG + Intronic
1092126544 12:6078770-6078792 GTCACGGCTCTGAGAGGGGAGGG - Intronic
1092900981 12:13059118-13059140 AGCACAGCTCAGGAATGGGAGGG + Intronic
1093690464 12:22102984-22103006 GCTACATCTCAGGGAGGGGTTGG + Intronic
1094000956 12:25693538-25693560 GTTACAGCTGAGGAAAGGGAGGG - Intergenic
1094065692 12:26358771-26358793 GCCACAGATGGGGGAGGGGAGGG - Intronic
1094719791 12:33052410-33052432 GTGGGTGCTCAGGGAGGGGACGG - Intergenic
1096681628 12:53259308-53259330 GTCCCTGCCCTGGGAGGGGAGGG + Intergenic
1096804641 12:54133095-54133117 GTCAGAGGTGAGGGAGGGTAGGG + Intergenic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1100581165 12:95942367-95942389 GACACAGCTGAGGGGTGGGAGGG + Intronic
1101330669 12:103755363-103755385 GCCACAGTTCTGGGAGGCGAAGG - Exonic
1101870193 12:108559738-108559760 GACACAGGGCAGGGAGGAGAGGG - Intronic
1101995591 12:109523039-109523061 GTCAGAGGTGAGGGAGGGAAAGG - Intronic
1102266627 12:111491492-111491514 CTCACAGCTCTGGGAGGAGAGGG + Intronic
1102398248 12:112606107-112606129 GTCACAGCTTGTGGAAGGGAAGG - Intronic
1102491589 12:113292752-113292774 ATCACAGCAGAGGGAGGGGAAGG + Intronic
1102540628 12:113616638-113616660 GGCACAGGGCAGCGAGGGGATGG + Intergenic
1102550980 12:113692074-113692096 GTCACAGCTTGGTGAGGGGAGGG + Intergenic
1102629811 12:114268128-114268150 ATTAAAGCTCAGAGAGGGGAAGG + Intergenic
1102641913 12:114374282-114374304 GACACGGCTTAGGGTGGGGATGG + Intronic
1102919375 12:116780290-116780312 TCCACAGATCAGGGTGGGGATGG + Intronic
1103237442 12:119385197-119385219 GGCACAGAGCAGGGAGGAGAAGG - Intronic
1103394454 12:120597283-120597305 GTCCCAGCTCAGTGAGGGAATGG - Intergenic
1103664494 12:122552233-122552255 CTGACAGACCAGGGAGGGGAAGG + Intronic
1104089471 12:125503218-125503240 AGCACAGCCCGGGGAGGGGAGGG - Intronic
1104267209 12:127244643-127244665 TTCACACTTCAGGGAGAGGAGGG - Intergenic
1104957725 12:132474621-132474643 GGCACCGCGGAGGGAGGGGAAGG - Intergenic
1104957734 12:132474643-132474665 GTCACCGCGGAGGGAGGGGAAGG - Intergenic
1104957870 12:132474964-132474986 GTCACCGCGGAGGGAGGGGGAGG - Intergenic
1104958042 12:132475358-132475380 GTCACCGCGGAGGGAGGGGGAGG - Intergenic
1104958053 12:132475382-132475404 GTCACCGCGGAGGGAGGGGGCGG - Intergenic
1105068098 12:133217352-133217374 GCCTCAGCCCAGGGATGGGATGG + Intergenic
1105288225 13:19025674-19025696 GGCACAGCTTTGGGTGGGGAGGG - Intergenic
1105727705 13:23182288-23182310 GCCACAGATTAGGGAGTGGAGGG - Intronic
1105991276 13:25623994-25624016 CTTACAGCCCAGGAAGGGGAAGG - Intronic
1106132588 13:26952379-26952401 GTCCCAGGGCAGGGAGGAGATGG - Intergenic
1106466184 13:30016403-30016425 GTCTCAGCTCAAGAAGAGGAAGG - Intergenic
1106760161 13:32859994-32860016 CTCACAGCTCCGGGAGGAGGAGG - Intergenic
1110119114 13:71861032-71861054 GTCACATCTCAGGGAGTTGGGGG + Intronic
1112431301 13:99352736-99352758 CTCTAAGCTCAGGGAGAGGAGGG - Intronic
1113104411 13:106757752-106757774 GCCTCAGCTCCGGGAGGGGTGGG + Intergenic
1113397928 13:109965936-109965958 GTCACACCTCAGGGTGGGGAGGG - Intergenic
1113743095 13:112724636-112724658 GTCAGAGGTCAGGCTGGGGATGG + Intronic
1113827168 13:113265296-113265318 GTCCCAGCTATGGGAGGGCAAGG + Intronic
1113963923 13:114141122-114141144 GTCAGGGGTCAGGGAGGGGCAGG + Intergenic
1115448497 14:33519286-33519308 GACAAAGCTCAGGGAGGGCTTGG - Intronic
1116806546 14:49499560-49499582 ATCACAGCTCAATGTGGGGAAGG + Intergenic
1117340893 14:54790180-54790202 GTCACTGCTGAGGGAGAGGAGGG + Exonic
1117652099 14:57917919-57917941 GTCACAGCTAAAGGTGAGGAGGG - Intronic
1118594218 14:67423498-67423520 ACCACAGGTGAGGGAGGGGAGGG + Intergenic
1118840234 14:69504419-69504441 TTCAGAGCCCAGGGAGGGGTGGG - Intronic
1118892390 14:69921172-69921194 CTCACAGCCCAGGGAGGCCATGG + Intronic
1119249246 14:73137673-73137695 GCCAGAGCTGAGGAAGGGGAGGG + Intronic
1119320177 14:73725932-73725954 GTCACAGCCCTGGGTGGGGGCGG - Intronic
1119383137 14:74241014-74241036 GCCTGAGCTCAGGGATGGGACGG + Intronic
1119420415 14:74504876-74504898 GTTTCAGCTCAGAGTGGGGAGGG + Intronic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1120181109 14:81343009-81343031 ACCACATCTCAGGGAGGGTAGGG + Intronic
1121092772 14:91194350-91194372 CTCACAGCACAGGGAAGGGCTGG + Intronic
1121271465 14:92640895-92640917 GTCAGAGGGCAGGGAGGGGTGGG + Intronic
1121311521 14:92937898-92937920 GCCACAGCTCGGGAAGGAGAAGG + Exonic
1121829933 14:97042597-97042619 GTCACTGCTTAGGCAGAGGATGG + Intergenic
1122119374 14:99543763-99543785 ATCACAGCTCTCGGAGGGGCAGG + Intronic
1122125621 14:99577001-99577023 GGGACTGATCAGGGAGGGGAGGG - Intronic
1122235994 14:100330856-100330878 GTCACGCATCAGGGAGGGGTGGG + Intergenic
1122305713 14:100765123-100765145 GTGGCAGATCAGGGAGGGGGAGG - Intergenic
1122935388 14:104953607-104953629 GACACAGAGCAGGGAAGGGAAGG - Exonic
1125507713 15:40276611-40276633 TTCACAGTTCTGGGCGGGGAGGG - Exonic
1127701346 15:61504520-61504542 ATCTCAGCTCAGTGTGGGGAGGG - Intergenic
1127836940 15:62797672-62797694 GGCATACCTGAGGGAGGGGAAGG + Intronic
1128152706 15:65373209-65373231 GACACAGGCCAGGGAGGGTATGG + Intronic
1129595341 15:76959501-76959523 GTCACAGCTCATGGAGGTAGAGG - Intergenic
1129851995 15:78798721-78798743 TTCAGAGTCCAGGGAGGGGAGGG + Intronic
1130251004 15:82300366-82300388 TTCAGAGTCCAGGGAGGGGAGGG - Intergenic
1131228316 15:90643038-90643060 GACACAGCTCTGGGGAGGGATGG - Intronic
1131401094 15:92126196-92126218 GTCGCAGCCCAGGAAGAGGAAGG - Exonic
1131779433 15:95840711-95840733 GTCAGAGCACAGGGAGTGAATGG + Intergenic
1132864040 16:2084932-2084954 GAAACTGCACAGGGAGGGGATGG - Exonic
1133124885 16:3640349-3640371 TTCAGAGCTCAGGGAGGCCAAGG - Intronic
1133233866 16:4378773-4378795 GTCTCACCTTAGGGAGGTGAGGG + Intronic
1134765699 16:16755734-16755756 CAGACACCTCAGGGAGGGGAAGG - Intergenic
1134980354 16:18603485-18603507 CAGACACCTCAGGGAGGGGAAGG + Intergenic
1135494238 16:22937661-22937683 TTCACAGCTGAGGGAGAGAAGGG - Intergenic
1135537417 16:23304812-23304834 ACTACGGCTCAGGGAGGGGAAGG - Intronic
1136059705 16:27718180-27718202 GCCAAAGCTCAGCGAGGGGTGGG - Intronic
1136229175 16:28876980-28877002 GTGAAAGGTCAGTGAGGGGAAGG - Intergenic
1136234848 16:28907104-28907126 GACAGATCTCAGGGTGGGGAAGG + Intronic
1136393071 16:29977606-29977628 GGCACTGCTGAGGAAGGGGAGGG - Intronic
1137462439 16:48677692-48677714 GGCACAGTTCAGGGATGGGAAGG + Intergenic
1137587958 16:49675466-49675488 GGCACCGCTGAGGGAGGGGTGGG - Intronic
1137600303 16:49751945-49751967 CCCACAGCCCAGGGAGGGCAAGG + Intronic
1137730196 16:50683963-50683985 GACACAACCCAGGGAGGAGAGGG - Intergenic
1137945324 16:52728514-52728536 TTCACAGACCAGGGAGGGGCAGG + Intergenic
1138334264 16:56240209-56240231 GTCTCAGCTCAGTGTGTGGAGGG + Intronic
1139367828 16:66444466-66444488 GTCACAGTGCAGGGGGAGGATGG + Intronic
1140037933 16:71385207-71385229 GGGACAGCCCAGGGAGGGGTGGG - Intronic
1141648141 16:85378262-85378284 GACCCAGCTGAGGGAGGGGCTGG - Intergenic
1141674100 16:85508560-85508582 GCCACAGCTGAGGGGGTGGACGG - Intergenic
1141900328 16:86986862-86986884 CTCCCAGATCAGGGAGGGGAGGG + Intergenic
1142597348 17:1036001-1036023 GTGACAGCTGGGGGTGGGGACGG + Intronic
1143103172 17:4515031-4515053 AGCACAGCCCAGGGAGGGGGCGG + Intronic
1144519117 17:15942728-15942750 GTCACAGGACGGGGCGGGGATGG - Intergenic
1145117510 17:20225190-20225212 CTCACAGCTCTGGGCGGAGAGGG - Intronic
1145716147 17:27023947-27023969 GACACAGCTTTGGGTGGGGAGGG - Intergenic
1145755895 17:27389870-27389892 GTCCCAGGTCAGGGAGATGAGGG - Intergenic
1147364421 17:39951106-39951128 TCCACAGGGCAGGGAGGGGAGGG - Intergenic
1147409549 17:40239637-40239659 GTCACAGCTAAGGGCAGTGACGG - Intronic
1147563601 17:41523466-41523488 GTCCCAGGAAAGGGAGGGGAGGG - Intergenic
1147914357 17:43877732-43877754 GTCACAGGTCAGGAGGGGGATGG + Intronic
1147944964 17:44075742-44075764 GTCACGGCTCAGGGAGGCAAAGG - Exonic
1148588669 17:48799229-48799251 GTCACAGCCCACTGTGGGGAGGG - Intronic
1148858635 17:50592721-50592743 GGCAGAGCTGAGGGAGAGGAGGG - Intronic
1148902605 17:50889668-50889690 GTCAGAGCTCAGAGCTGGGAGGG - Intergenic
1149323849 17:55509732-55509754 CTCTGAGCTCAGGGAAGGGAGGG + Intergenic
1149685669 17:58533146-58533168 GTCAGAACTCAGCCAGGGGAGGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150250208 17:63700606-63700628 CCCACAGCTCTGGGCGGGGATGG - Intronic
1150673174 17:67220176-67220198 GTTACAGCACAGCGAGGAGAGGG - Intronic
1151272946 17:73011095-73011117 ATGACAGCCCAGGGAAGGGAAGG + Intronic
1151536718 17:74743115-74743137 GTCCCAGATCTGGGAAGGGATGG - Exonic
1151696720 17:75721683-75721705 GTCAGCCTTCAGGGAGGGGAAGG - Intronic
1151802314 17:76385489-76385511 GCCACGGCTCCGGGCGGGGAAGG + Exonic
1152018715 17:77769218-77769240 GTCACAGCTCAGGTGGGAGTGGG + Intergenic
1152033672 17:77858726-77858748 GTCACAGCTTATGGACTGGATGG - Intergenic
1152745010 17:82034506-82034528 GGCACATGTCAGGGAGGGGTGGG + Intergenic
1154019248 18:10648134-10648156 AACACAGCTCAGGGAAGGGTAGG - Intergenic
1154184968 18:12175090-12175112 AACACAGCTCAGGGAAGGGTAGG + Intergenic
1154471492 18:14706906-14706928 GGCACAGCTTTGGGTGGGGAGGG + Intergenic
1154494861 18:14948200-14948222 GACACAACTCAGGGAGGTGTAGG + Intergenic
1155106046 18:22667358-22667380 GACACAGCCCAGGCAGGGGAGGG + Intergenic
1158128075 18:54123643-54123665 ATCCCAGCTGAGGGTGGGGAAGG + Intergenic
1159436659 18:68426618-68426640 GTCACAGGTCAGGGAGGTTATGG + Intergenic
1160291725 18:77600902-77600924 GTGGCAGCACAGAGAGGGGAAGG - Intergenic
1160748782 19:723944-723966 CCCACAGACCAGGGAGGGGAGGG + Intronic
1160868219 19:1265543-1265565 GTCACAGCTCAGGAATGTGGAGG - Intronic
1160880673 19:1318640-1318662 GTCCCAGCTCAGCGAGGAGTGGG + Intergenic
1160926957 19:1551062-1551084 GGCACAGCTCAGGGAAGCCAAGG - Intergenic
1161441539 19:4294556-4294578 GTAACAGCCCAGGTAAGGGAGGG - Exonic
1161563869 19:4988730-4988752 GTCACAGCCCGGGGAGAGCACGG - Intronic
1161683989 19:5694219-5694241 GTCTGGGCTGAGGGAGGGGAAGG - Intronic
1161827773 19:6580465-6580487 GTCCCAGCTGAGAGAGGGGAAGG - Intergenic
1162080295 19:8214013-8214035 GTCCAGACTCAGGGAGGGGAAGG - Intronic
1162327984 19:10010106-10010128 GTGACAGCTCGGGGTGGGGGTGG - Intronic
1162682754 19:12359035-12359057 GGCACAGCAAAGGAAGGGGAGGG + Intronic
1163161084 19:15464441-15464463 GGCAGAGCTGAGGGTGGGGAGGG - Intronic
1163729734 19:18941846-18941868 GTCCCTGCTTAGGGATGGGACGG - Intergenic
1165299640 19:34960680-34960702 GGGGCAGCTCAGGGAGAGGAGGG + Intronic
1165301548 19:34972874-34972896 GTGAAAGCTCAGGGGTGGGATGG - Intergenic
1165404570 19:35621838-35621860 GTCACAGGGCAGGGATGGGATGG + Intronic
1165739264 19:38195855-38195877 GTGACAGCTCAGGATGGTGATGG - Intronic
1165745246 19:38226734-38226756 GTCACAGCTCACCGTGGGTAAGG - Intronic
1166054676 19:40281171-40281193 CTCACAGCTCTGGGAGTGGCAGG - Intronic
1166129522 19:40737628-40737650 GTCAGAGCTCAAGGTGGGCAAGG + Intronic
1166160955 19:40952616-40952638 ATGACAGCTCTGGGAGGGCAGGG + Intergenic
1166190358 19:41172785-41172807 TTCTCACCTCAGGGAGGGGCAGG - Intergenic
1166782240 19:45348781-45348803 GGCACAGGTCAGGGATGGGCAGG - Intronic
1167659187 19:50786028-50786050 GGCAGAGGGCAGGGAGGGGAAGG - Intergenic
1168244563 19:55105274-55105296 GTCTCAATTCAGGGAGGGGAAGG + Intronic
925040094 2:725910-725932 GTCGCAGTCCAGGGAGGAGATGG + Intergenic
925272999 2:2627964-2627986 GTCAGAGAGCAGGGAGGGGAGGG - Intergenic
925279077 2:2670119-2670141 GTCCCAGCTCAGGGACTTGAGGG - Intergenic
925457064 2:4024766-4024788 GTCCCAGCTCAGGCAGTGGCTGG - Intergenic
926001008 2:9332368-9332390 GACACACCTCAAGGAGGGTACGG + Intronic
927847360 2:26478468-26478490 GCAACAGCTCAGGGAAGGGCGGG + Intronic
928510271 2:31996426-31996448 GTCCCAGCTGAGGGAGGCTAAGG + Intronic
929587583 2:43126141-43126163 GTCACAACTTGGGGAGGGGGCGG - Intergenic
930723919 2:54664529-54664551 ATCAGAGGTCGGGGAGGGGATGG - Exonic
931608200 2:64073157-64073179 GGCACAGCTGAGGGGGGAGATGG - Intergenic
932307940 2:70717058-70717080 GTCCCAGCTGAGGGAGGTGAGGG - Intronic
932507731 2:72252712-72252734 ATCACAGATCAGGGAGGGAGGGG + Intronic
934476691 2:94598411-94598433 TTCACTGATCAGGGAGAGGAGGG + Intronic
934759271 2:96844542-96844564 CCCACAGCACAGGGAAGGGAAGG - Intronic
935512474 2:103993253-103993275 GTCACATCTTAGGGAAGGAAAGG - Intergenic
935658350 2:105443947-105443969 TTCTCAGCTCAGGGAGGGAGAGG - Intergenic
936078667 2:109417820-109417842 GTAACCACTCAGGGAGGGGCAGG + Intronic
936595128 2:113840302-113840324 GTGACCGCCAAGGGAGGGGATGG + Intergenic
937250002 2:120517614-120517636 GCCACAGGATAGGGAGGGGAGGG - Intergenic
937612780 2:123882267-123882289 GTCTCATCTTAGGGAGAGGAGGG - Intergenic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
940430452 2:153584041-153584063 GTGACAGCTGGGGTAGGGGAGGG + Intergenic
942486769 2:176448073-176448095 GATACAGCTCATGGAGAGGAGGG - Intergenic
946273828 2:218615799-218615821 TGTACAGCTCAGGGAAGGGAAGG + Intronic
946907263 2:224429238-224429260 GGCACAGACCAGGGAGGAGAAGG - Intergenic
947016556 2:225627021-225627043 GTCAAAGCTCAGGAATGGGATGG + Exonic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
947952190 2:234158021-234158043 GTGAAACCTTAGGGAGGGGATGG - Intergenic
948147172 2:235716509-235716531 GTCCCAGCTCAGGGAATGGCAGG + Intronic
948396557 2:237649208-237649230 GGCACAGCTGTGGGTGGGGAGGG - Intronic
948605985 2:239135408-239135430 GGCAGAGCTCAGGAAGGGGAAGG + Intronic
1168964784 20:1892795-1892817 GGCCCAGCACAAGGAGGGGAAGG - Intergenic
1169623874 20:7540569-7540591 GTCACAGCTCTGGGAGAAAAGGG + Intergenic
1169832570 20:9839806-9839828 GTCCCAGCTCAGGAAAGGCAAGG - Intergenic
1170434353 20:16310221-16310243 GTCACAGCCAAGGGAAGGAAGGG + Intronic
1170701738 20:18709827-18709849 GTTAGAGGTCAGGGAGGGGTGGG + Intronic
1171376095 20:24694994-24695016 GACACAGCTCAGGGACAGCATGG - Intergenic
1172228225 20:33319590-33319612 CTCTCAGCTCAGGGAGGTGCTGG + Intergenic
1172447414 20:35000473-35000495 GGCACAGCTCAAGGAGGAGCAGG + Exonic
1172838425 20:37887669-37887691 CTCACAGCTCAGTCAGGGGCGGG + Intergenic
1172840305 20:37898958-37898980 GACACCTCTCAAGGAGGGGAGGG + Intergenic
1172948429 20:38706162-38706184 GTCACCTCTCAGGGTGGGGTGGG + Intergenic
1173159433 20:40641382-40641404 GTAAAGGCTCAGAGAGGGGAAGG - Intergenic
1173378416 20:42511997-42512019 GGCTCAGCTCAGGGAGAGGGAGG - Intronic
1173590032 20:44217475-44217497 CTCAGAGCTCCAGGAGGGGAGGG + Intergenic
1173873773 20:46357284-46357306 GTCACAGCCCTGCGAGGGCAGGG + Intronic
1174085881 20:48006836-48006858 GTCACACCACAGGGAGAGTAGGG + Intergenic
1174364863 20:50050528-50050550 GTCAGAGGGAAGGGAGGGGAGGG + Intergenic
1175252588 20:57618376-57618398 GTCACAGCACTTGTAGGGGAGGG + Intronic
1175537825 20:59727437-59727459 GCCACAGCTTAGAGAAGGGATGG + Intronic
1175788330 20:61725747-61725769 GCCAGAGGTGAGGGAGGGGAAGG + Intronic
1175791997 20:61745706-61745728 GGCACAGCTCAGGGAGGGAAGGG - Intronic
1175805009 20:61822555-61822577 GCCACACGGCAGGGAGGGGAGGG + Intronic
1176129676 20:63491405-63491427 CTCACAGCCCTGGGAGGTGAGGG - Intronic
1176270201 20:64232322-64232344 GTCACAGCCCGGGGTGGGGCAGG - Exonic
1176674677 21:9767498-9767520 GTCGAAGCTCAGGGAGGGCGAGG - Intergenic
1176802988 21:13451029-13451051 GGCACAGCTTTGGGTGGGGAGGG - Intergenic
1177416238 21:20796940-20796962 GTCAGAGGTCAGGGAGTGGAAGG + Intergenic
1178639822 21:34337014-34337036 GTGCCAGCCCAGGGAGGGGAGGG - Intergenic
1178678748 21:34653790-34653812 GACAGAGGTCAGAGAGGGGAGGG + Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178815445 21:35925102-35925124 GTCACATCTCAGCAAGGGGCTGG - Intronic
1178849855 21:36204127-36204149 GTCACAACTGGGGGTGGGGAGGG + Intronic
1179097066 21:38325388-38325410 GCCACAGCTCAGCAATGGGAAGG + Intergenic
1179513767 21:41892422-41892444 GATACAGCCCTGGGAGGGGAGGG + Intronic
1179714237 21:43279651-43279673 GGCAGAGCTCAGGGAAGGGGCGG + Intergenic
1179727315 21:43347686-43347708 GTCACAGCCCAGGCAGGGAAGGG + Intergenic
1180211924 21:46299944-46299966 GTCACACCTGAGGGTGGGGCAGG - Intergenic
1180614416 22:17118666-17118688 TTCTCAGCTCAGGGAGAGGAGGG - Exonic
1180908568 22:19432320-19432342 CTCCCAGCACAGGGCGGGGACGG + Exonic
1181492889 22:23271744-23271766 AGAACAGCTCAGGGAGGGCAGGG + Intronic
1181940219 22:26470106-26470128 GTCACAGCCCAGGGCAGGCAGGG - Intronic
1182028365 22:27138028-27138050 GTCACAGCGCAGTGATGGGTAGG + Intergenic
1182084872 22:27554671-27554693 ATCACAGCGGAGGGCGGGGAGGG + Intergenic
1182352077 22:29704797-29704819 GAGACAGCTCAGGGTTGGGAGGG + Intergenic
1182554311 22:31120794-31120816 GTCTGAGCTCAGGGAGCGGGTGG + Intergenic
1182881448 22:33737360-33737382 CTGACAGCTCTGGGAGGGCAGGG - Intronic
1183165239 22:36142667-36142689 GTTAGACCTCAGGGAGGGGCTGG + Intronic
1183179179 22:36247094-36247116 GTGAGACCTCAGGGAGGGGCTGG - Intergenic
1183181658 22:36264220-36264242 GTTAGACCTCAGGGAGGGGCTGG - Intronic
1183648178 22:39138743-39138765 GTGACATCTAAGGGAAGGGAAGG + Intronic
1184186591 22:42869033-42869055 GTCCCAGCTCAGCAAGGGTATGG - Intronic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184433305 22:44454310-44454332 GCCACAGCTCAGGGAGGGCAGGG + Intergenic
1184598660 22:45529531-45529553 GGCAAAGCTCAGAGAGAGGAGGG - Intronic
1184610048 22:45597593-45597615 GACCCAGCCCAGGGAGGGGCAGG + Intronic
1184868569 22:47218875-47218897 GTCACGGCCCAGGGAGGTGTGGG + Intergenic
949219040 3:1607365-1607387 GTCACAGCTTGGGGAGGGGGTGG + Intergenic
949649930 3:6145518-6145540 GCCACAGCTTAGAGAGGGGTGGG - Intergenic
950097240 3:10337413-10337435 GTCACAGCCCTGCGAGGGGAGGG - Intronic
950366402 3:12488156-12488178 GCCAAAACTGAGGGAGGGGAAGG - Intronic
950677678 3:14564441-14564463 GCCATGTCTCAGGGAGGGGACGG + Intergenic
952883176 3:37998036-37998058 GAGACAGATCAGGGAGGGGCTGG + Intronic
954438894 3:50510864-50510886 GACACCGGGCAGGGAGGGGAAGG + Intergenic
954914273 3:54135626-54135648 GTCACATCCCAGGGAGGCGCTGG - Intronic
955812074 3:62801795-62801817 GTCACACATGAGGGAGGTGAAGG + Intronic
956680499 3:71775008-71775030 GTCACAACTAAGGGCAGGGAGGG + Intronic
960210288 3:114956502-114956524 TTCCCAGCTGAGGGAGGGAAAGG - Intronic
961865881 3:129953167-129953189 GCCACAGCTCAGGGAATGCAAGG - Intergenic
963040184 3:141064720-141064742 CTCTCAGGCCAGGGAGGGGAGGG + Intronic
963736188 3:149019995-149020017 GTCAGAGCTCATGCAGAGGAAGG - Intronic
964297044 3:155245363-155245385 GTCCCAGCTCAAGGAAGGGAGGG - Intergenic
967812362 3:193771568-193771590 GTCACAGCACAGAAATGGGAGGG - Intergenic
968689028 4:1980628-1980650 GTCAGTGCTCAGGGAGGCGTGGG - Exonic
968702821 4:2064810-2064832 AGCACAGCCCAGGCAGGGGAGGG - Exonic
969307958 4:6336441-6336463 GCCAGGGCTCAGGGAGGTGAAGG - Intronic
969703206 4:8779027-8779049 GTCAGAGGTCAGGGAGGGCACGG - Intergenic
972325112 4:38007875-38007897 GTCACATCCCAGGGAAGGCAGGG - Intronic
972542904 4:40055664-40055686 GTAACCGCAAAGGGAGGGGACGG + Intergenic
975651620 4:76598972-76598994 ATGACAGCTGTGGGAGGGGAAGG + Intronic
976107875 4:81639392-81639414 GTCACTGGGCAGGGTGGGGAGGG - Intronic
976871611 4:89800874-89800896 ATCACAGCTCAGGGGAGGAAGGG - Intronic
978361236 4:107932452-107932474 GTCACAGCTGGTGGAAGGGAAGG - Intronic
978843861 4:113248557-113248579 GACACAGAGCAGGGAGGAGAAGG + Intronic
979279266 4:118846933-118846955 GACACAACTCAGGGAGGGGAGGG + Intergenic
979522980 4:121689652-121689674 GTCACAGTGAAGGGAGGGGAAGG + Intronic
982358288 4:154491970-154491992 ATCACACGGCAGGGAGGGGAAGG - Intergenic
982468513 4:155759517-155759539 GTCACCGCTCCGGGAGAGGCTGG - Intronic
983782707 4:171691870-171691892 GTCAGAGCTGAGAGAGGGGAAGG + Intergenic
985105909 4:186500049-186500071 TTCACAGCTCAGGGGAGGGAGGG - Intronic
985530977 5:433706-433728 GGCACAGCGCAGTGAGGGGTCGG + Intronic
985655850 5:1131005-1131027 GACACAGAACAGGGAGGGGGTGG + Intergenic
985766990 5:1785325-1785347 GTCACAGGACAGGCAGGGGAGGG - Intergenic
985891356 5:2717584-2717606 GGCACAGCTCAAAGAGGGAAAGG - Intergenic
985901207 5:2795696-2795718 GTCAAAGCTCAGGAAGGGCCTGG + Intergenic
986324570 5:6662285-6662307 CACACAGCTCATGGAGGGGGAGG - Intronic
987314720 5:16713540-16713562 GACACAGCCAGGGGAGGGGAGGG + Intronic
988412261 5:30901642-30901664 GTGACAGTGCAGGGAGGGGAGGG + Intergenic
989102524 5:37835748-37835770 GTGACTCCTCTGGGAGGGGAAGG - Exonic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
991023696 5:62007675-62007697 GTCACAGCTGAGTGAGGGTGGGG - Intergenic
992508355 5:77409549-77409571 GTTCTGGCTCAGGGAGGGGAAGG + Intronic
995394809 5:111676114-111676136 TTCACTTCTCAGGGAGAGGAAGG + Intronic
997008650 5:129850347-129850369 GGCACAGATCAGGGTGGAGAAGG - Intergenic
997262666 5:132476506-132476528 GTCACTGGTCAGAGAAGGGAGGG + Intergenic
997356120 5:133264072-133264094 GTCACAACTTGGGGAGGGGGTGG + Intronic
998265853 5:140667258-140667280 GTCATGGCTGAGGGTGGGGAAGG - Intronic
999312686 5:150561968-150561990 GACAAAGGTCAGGGAGTGGAAGG - Intergenic
1000060680 5:157652413-157652435 GTCGCAGCTCCGGGTGGGGGAGG - Exonic
1000218936 5:159192962-159192984 GTCTCAGCTCAGGCTGAGGATGG - Intronic
1000295814 5:159912498-159912520 GGCAGAGGTCAGGGAGGGGAGGG - Intergenic
1001445626 5:171780426-171780448 GTCTCAGGGCAGGGAGGAGAGGG - Intergenic
1001576468 5:172767703-172767725 AGCACAGCTCAGAGATGGGAAGG + Intergenic
1001953345 5:175831309-175831331 ATCGTAGCTCAGAGAGGGGAAGG + Intronic
1001953382 5:175831487-175831509 GTCAAAGCCCAGGGAGAAGATGG - Intronic
1002009942 5:176271048-176271070 CTCACAGCACCGGGAGGAGAGGG + Intronic
1002327636 5:178420393-178420415 GTCACATCTCAGGGAGGGGAGGG - Intronic
1002327751 5:178420695-178420717 GTCACATCTCAGGGAGGGGAGGG - Intronic
1002603929 5:180370884-180370906 GCCACAGCTCAGGGAGGGGCAGG + Intergenic
1002876550 6:1215788-1215810 GTCTCAGCTCTGGTTGGGGAAGG - Intergenic
1003264251 6:4551619-4551641 GTGACAGCCCAGGAAGAGGAAGG - Intergenic
1003369804 6:5513199-5513221 GTGACAGGTGAGGGAGGGAATGG + Intronic
1003512401 6:6792372-6792394 GTAACTGATCTGGGAGGGGAGGG - Intergenic
1004187307 6:13432005-13432027 AACACAGCTCAGGGAGGAGAGGG + Intronic
1004228535 6:13810696-13810718 CTCACAGCTTGGGAAGGGGAGGG + Intronic
1004263563 6:14129656-14129678 ATCTCAGCTCAGGGCTGGGAGGG + Intronic
1006806695 6:36793699-36793721 CTCACAGCCCAGGGAGAGCATGG - Intronic
1007249632 6:40487022-40487044 GTCACATACCTGGGAGGGGATGG + Intronic
1007318658 6:41010373-41010395 GTCCCAGCTCAGGGAGAGGAGGG - Intergenic
1007358043 6:41335198-41335220 GGCAAAGGTCGGGGAGGGGAGGG - Intergenic
1007632132 6:43278324-43278346 GGCACAGTGCATGGAGGGGAGGG + Intronic
1010741548 6:79511450-79511472 GTCATAGGTTAGTGAGGGGAAGG + Intronic
1010950233 6:82027985-82028007 GTAACTGCTGAGGGAGGAGAAGG - Intergenic
1011475075 6:87743710-87743732 GTGACAGGTCTGGGAGGGGCAGG + Intergenic
1011640538 6:89412558-89412580 GTCCCCGCACAGGCAGGGGAGGG + Intergenic
1015735029 6:136390003-136390025 GAGTCAGCTCAGGGATGGGAAGG + Intronic
1015796381 6:137016143-137016165 GTCACAGCCCAGGGAGAAGCTGG - Intronic
1016854124 6:148649581-148649603 GTCAGAGCTTAGAGAGGGGAGGG - Intergenic
1017184610 6:151588425-151588447 GACACAGCTGAGGGAAGGTAGGG + Intronic
1017582885 6:155886615-155886637 GTCAGAGATCAGTGAGGTGATGG - Intergenic
1017813873 6:158002999-158003021 GCCACAGCTCAGTGCAGGGAGGG + Intronic
1018859919 6:167704053-167704075 GACTCAGCCCTGGGAGGGGAGGG + Intergenic
1019286595 7:226327-226349 GTCACAGTGCAGGGGGTGGAAGG + Intronic
1019379718 7:714469-714491 GTCACAGCTCAGTGGGGCCAGGG - Intronic
1019551858 7:1607002-1607024 GTCACAGATAAGTGAGTGGAGGG - Intergenic
1019750368 7:2725338-2725360 GACACAGCTGCGCGAGGGGAAGG + Intronic
1019807628 7:3139929-3139951 GTGACAGCCCAGGGTGGGGTAGG + Intergenic
1020051579 7:5085484-5085506 CTCACACCTCAGGGAGGGAGTGG + Intergenic
1020390591 7:7653825-7653847 GTCACAGCTGGGGGATAGGAAGG + Intronic
1020763113 7:12291570-12291592 GCCACAACTCAGGGAAGGAAAGG + Intergenic
1022410031 7:30132342-30132364 GTCACAGTGGAGAGAGGGGAGGG + Intergenic
1023927112 7:44677509-44677531 GACACAGAGCAGGGAGGGGCCGG + Intronic
1024009156 7:45253079-45253101 ACCACAGCCAAGGGAGGGGAGGG - Intergenic
1024117052 7:46204483-46204505 TTCAGGGCTTAGGGAGGGGATGG - Intergenic
1025104018 7:56156141-56156163 AGCACAGCTGAGTGAGGGGAAGG - Intergenic
1025265375 7:57452055-57452077 GACACAGCTGAGGAAGGGCATGG - Intronic
1025732505 7:64118987-64119009 TTCAGAGCTCAGGCAGGGCATGG - Intronic
1026188992 7:68107362-68107384 TTTACAGCTCAGTGAGGAGAGGG - Intergenic
1026817490 7:73523555-73523577 GTCACAGCTCTGGCAGGGCGTGG - Intergenic
1026848094 7:73708774-73708796 GTCAGGGCTCAGGGGGAGGACGG + Intronic
1026891706 7:73986255-73986277 ATCCCAGCTCAGGGAGGGTGGGG + Intergenic
1027141252 7:75659272-75659294 TTCCCAGCTCAGTAAGGGGAGGG + Intronic
1027231164 7:76273431-76273453 GTCTCATCCCAGGGATGGGAGGG - Intronic
1027733777 7:81907186-81907208 CTCACAGTTCAGGGATGGGGAGG + Intergenic
1029445785 7:100612296-100612318 GTCCGAGCTTAGGGAGGGGCCGG + Intronic
1029545279 7:101207304-101207326 GTCCCTGTCCAGGGAGGGGAGGG + Intronic
1029897515 7:104000088-104000110 GGCATAGTTCAGGGAGGAGAAGG - Intergenic
1031689212 7:124766334-124766356 GTCTCAGCTCTGGGGGGCGAGGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033222860 7:139540229-139540251 GCCAAAGCTGAGGCAGGGGAGGG + Intronic
1033361820 7:140643381-140643403 GTCAAAGATGAGGGAGTGGAAGG - Intronic
1034123161 7:148645540-148645562 GGCACAGCCCAGGTAGGTGAGGG - Intergenic
1034412935 7:150950662-150950684 GTGACAGCCCAGGGCGGGAATGG - Intronic
1034433578 7:151052578-151052600 GTGACGGCACAGGGAGGGGTGGG - Exonic
1034975231 7:155444953-155444975 GTCACGGGGCGGGGAGGGGAGGG + Intergenic
1035034422 7:155885748-155885770 CTCACAGCCCTGGGAAGGGAAGG - Intergenic
1035756978 8:2041953-2041975 GCCACAGCACAGGGAGGGGCAGG - Intergenic
1038481234 8:27903038-27903060 ATCATGCCTCAGGGAGGGGAGGG + Intronic
1039925977 8:41932812-41932834 GTCCCAGCTAAGGGATGAGATGG + Exonic
1041081125 8:54215871-54215893 GCCCCAGCTCAGGCAGGGCAGGG - Intergenic
1041351928 8:56955775-56955797 CTTACAGCCCATGGAGGGGAAGG - Intergenic
1041452802 8:58025234-58025256 GTCAAAGCTCAGGGAGGTCAAGG + Intronic
1042128269 8:65560514-65560536 GCCAGAGATCAAGGAGGGGAAGG - Intergenic
1045294315 8:100860453-100860475 GTCCCAGCTCAGGCCGTGGAGGG - Intergenic
1045444731 8:102248900-102248922 GTCATAGCTGTGGGAGGGCAGGG + Intergenic
1046104262 8:109647213-109647235 GGGACAGGTTAGGGAGGGGAGGG - Exonic
1047449535 8:124952533-124952555 ATCACAGCTAAGGGAGTGAAGGG - Intergenic
1047512691 8:125527879-125527901 GTAACAGCCCAGAGATGGGAAGG - Intergenic
1047526363 8:125637752-125637774 ATCACAGCTGAAGGAGGGGGTGG + Intergenic
1048317648 8:133374272-133374294 GTCAGAGCTGAGGAAGGGCATGG - Intergenic
1048990623 8:139758167-139758189 GTCACCCCTCAGGGCCGGGATGG + Intronic
1049205282 8:141360801-141360823 GTCTCAGCTGAGGGAGTGGCAGG - Intronic
1049374153 8:142281131-142281153 GCCACAGCTCAGTCAGGGCATGG + Intronic
1049504693 8:142989789-142989811 GTCCCAGCTCAGAGACGGCAAGG - Intergenic
1052075481 9:24135348-24135370 CACACAGCTCATGGAGGGGGTGG - Intergenic
1052849542 9:33368561-33368583 GTCACTTGTCAGGGAGAGGAAGG + Intronic
1052853339 9:33391494-33391516 TTCACTGATCAGGGAGAGGAGGG - Intronic
1053681371 9:40487666-40487688 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1053931361 9:43115996-43116018 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054282342 9:63137268-63137290 TTCACTGATCAGGGAGAGGAGGG + Intergenic
1054294460 9:63323182-63323204 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054392481 9:64627670-64627692 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054427129 9:65132879-65132901 TTCACTGATCAGGGAGAGGAGGG - Intergenic
1054503246 9:65888660-65888682 TTCACTGATCAGGGAGAGGAGGG + Intronic
1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG + Intergenic
1056969160 9:91188044-91188066 TTCACAGCTTAGGGAGGGAAAGG - Intergenic
1057130807 9:92653356-92653378 GTGACGGCGCAGGGTGGGGAAGG - Intronic
1057479582 9:95434135-95434157 CTCAGAGCTCAGGGAGTGGAGGG - Intergenic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1059679468 9:116572199-116572221 GTCACAGCCTGGGGAGGAGAAGG - Intronic
1059798323 9:117724180-117724202 GCCACAGCTCAGGAAGGGAGCGG - Intergenic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060479884 9:124011862-124011884 GGCGCACCCCAGGGAGGGGAGGG + Exonic
1060521004 9:124294024-124294046 TTTAAGGCTCAGGGAGGGGACGG + Intronic
1060633664 9:125182777-125182799 GTCACAGCTGGGTCAGGGGAGGG - Intronic
1060790583 9:126483054-126483076 GCGGCAGCTCAGGGATGGGAGGG - Intronic
1061575511 9:131503473-131503495 GATGCAGCTCAGGGAGGGAAGGG + Intronic
1061615494 9:131776188-131776210 GTCCTTGTTCAGGGAGGGGAGGG - Intergenic
1061781152 9:132996733-132996755 GAGGCTGCTCAGGGAGGGGAGGG + Intergenic
1062467690 9:136688225-136688247 GTCCCACCTCAGGGAGCAGATGG + Intergenic
1185519056 X:724731-724753 GTCAGATCTCAGGTGGGGGAGGG - Intergenic
1186449446 X:9659985-9660007 GGCACTGCTTAAGGAGGGGAAGG - Intronic
1186732550 X:12425618-12425640 GTCACAGCTGAGGGTGGGTAGGG + Intronic
1188244088 X:27820429-27820451 GTGAGAACTCAGGGAGGGGAGGG + Intronic
1188442939 X:30230940-30230962 GGCGGATCTCAGGGAGGGGAAGG + Intronic
1188562941 X:31490442-31490464 GTCCCAGCTGAGGCAGGAGAAGG + Intronic
1189216202 X:39326959-39326981 GCCAGTGCTCTGGGAGGGGAAGG - Intergenic
1189373117 X:40445583-40445605 GACACAGCTCAGTGTGGGAAAGG + Intergenic
1189425953 X:40900140-40900162 CTGACACCTCAGGGAGAGGATGG - Intergenic
1190318385 X:49165384-49165406 GTCAGAGATCAGTGAGGAGAAGG + Intronic
1190622397 X:52300354-52300376 TGCACTGCTTAGGGAGGGGAAGG + Intergenic
1192147196 X:68689600-68689622 GTCTGAGCTTAGGGAGGGCAAGG + Intronic
1192358205 X:70423008-70423030 GTCCTGGCTCAGGGAGGCGAGGG - Intergenic
1194051896 X:89079581-89079603 GTGGCTGCTCAGGGAGGGGGAGG - Intergenic
1196520669 X:116667573-116667595 GTCCCAGCTCCGGCAGGGGTGGG + Intergenic
1198931437 X:141865664-141865686 CTAACAGCACAGGGAGGGCAGGG - Intronic
1198992291 X:142528532-142528554 GACATAGCTCAGGGGGAGGAAGG + Intergenic
1199270923 X:145881804-145881826 GTCACAGGTGGGGGTGGGGAAGG + Intergenic
1199980866 X:152919751-152919773 GGCTGAGCCCAGGGAGGGGAGGG - Intronic
1200686555 Y:6264470-6264492 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1200989430 Y:9335386-9335408 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1200992103 Y:9355719-9355741 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1200994756 Y:9375997-9376019 GTTGCAGCTGAGGGACGGGAGGG + Intronic
1200997419 Y:9396343-9396365 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1200999932 Y:9464879-9464901 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1201002592 Y:9485189-9485211 GTTGCAGCTGAGGGACGGGAGGG + Intronic
1201005248 Y:9505473-9505495 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1201007909 Y:9525802-9525824 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1201010525 Y:9545993-9546015 GTTGCAGCTGAGGGACGGGAGGG + Intergenic
1201438086 Y:13980802-13980824 GTCTCAGCTCCCGGAGGGAAAGG - Intergenic