ID: 903461675

View in Genome Browser
Species Human (GRCh38)
Location 1:23525017-23525039
Sequence CCCAGGGAGGTGCCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903461662_903461675 16 Left 903461662 1:23524978-23525000 CCGCCCAGACCCAGGGGACTTCC 0: 1
1: 0
2: 2
3: 35
4: 294
Right 903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 287
903461663_903461675 13 Left 903461663 1:23524981-23525003 CCCAGACCCAGGGGACTTCCTGG 0: 1
1: 0
2: 4
3: 36
4: 274
Right 903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 287
903461668_903461675 -5 Left 903461668 1:23524999-23525021 CCTGGCTCAGTGCCACAACCCAG 0: 1
1: 0
2: 1
3: 23
4: 433
Right 903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 287
903461665_903461675 12 Left 903461665 1:23524982-23525004 CCAGACCCAGGGGACTTCCTGGC 0: 1
1: 1
2: 1
3: 29
4: 254
Right 903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 287
903461667_903461675 6 Left 903461667 1:23524988-23525010 CCAGGGGACTTCCTGGCTCAGTG 0: 1
1: 0
2: 0
3: 31
4: 294
Right 903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 287
903461666_903461675 7 Left 903461666 1:23524987-23525009 CCCAGGGGACTTCCTGGCTCAGT 0: 1
1: 0
2: 0
3: 17
4: 203
Right 903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903461675 Original CRISPR CCCAGGGAGGTGCCCACAGT GGG Intronic
900097603 1:946356-946378 CCCTGGCAGGTGCCCTCAGGTGG + Intronic
900103171 1:971416-971438 CCCTGGGGCGGGCCCACAGTGGG - Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900473601 1:2866133-2866155 CCCATGGAGGGGCCCCCACTCGG - Intergenic
900476788 1:2879805-2879827 CCCAGGGATCTTCCCACAGGTGG - Intergenic
900633216 1:3649684-3649706 CCCGGGGAGGTGCCCCAAGCAGG - Intronic
900901213 1:5517291-5517313 CCCAGGGAGGAGCCAGAAGTAGG + Intergenic
900995672 1:6122024-6122046 CCCCGGGAGGTGGGCACAGCCGG + Intronic
901523547 1:9804445-9804467 CCCAGGGAGGCCCTCACAGGTGG - Intronic
901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG + Intergenic
901992376 1:13125962-13125984 CTCAGGGATCTTCCCACAGTGGG - Intergenic
902638518 1:17751026-17751048 CCCAGGGTAGGACCCACAGTGGG + Intergenic
902984346 1:20146530-20146552 CCCAGAGAGGAGCACAGAGTAGG - Intronic
903179296 1:21597367-21597389 CCCTGGGAGGGGCCCACCCTTGG + Intronic
903181129 1:21605485-21605507 CCCAGGGCTGCGCACACAGTAGG + Intronic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
903642657 1:24870678-24870700 CCCATGGAAGTCCCCAAAGTAGG + Intergenic
903977934 1:27163612-27163634 CACAGGGAGTTGCACATAGTAGG - Intronic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
904342162 1:29843629-29843651 CCCAGAGAGGTGACCTCAGCTGG - Intergenic
904461782 1:30685063-30685085 GCCCGGGAGGCGCCCACCGTGGG - Intergenic
904808497 1:33147980-33148002 CCCAGGGCGGAGCACATAGTGGG + Intronic
905386112 1:37605492-37605514 CCCAGGGCAGTGCTCACATTGGG + Intergenic
907260941 1:53218252-53218274 CCCAGCCAGGTGCCCACATGTGG + Intronic
910251243 1:85201073-85201095 CCCAGGGAGGAGCCCGCCGCTGG + Intergenic
910275435 1:85444674-85444696 CACAGTGAGGAGCACACAGTAGG - Intronic
910712118 1:90192983-90193005 GCCAGGAAGGTGCACAAAGTGGG - Intergenic
912983128 1:114397523-114397545 TTCAAGGAGGTGCCCACTGTAGG + Exonic
913289215 1:117257106-117257128 CCCAAGAAGGTGCCCTCAATGGG - Intergenic
915142827 1:153777638-153777660 CCCTGGGAAGGGCCCACTGTGGG - Intronic
917944582 1:179955277-179955299 CCCAGGGAGGTTCCCCGAGGGGG - Intronic
920092702 1:203465612-203465634 CCCAGGTCGGTGCCCAGAGAGGG - Intergenic
920281886 1:204849718-204849740 CCCCTGGAAGTGCCCGCAGTTGG + Intronic
920316101 1:205076634-205076656 CCTGGAGAGGTGCCTACAGTTGG - Exonic
920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG + Intronic
921049669 1:211502013-211502035 CACAGGGAGGTGCCCAGCCTCGG - Intergenic
922474767 1:225899282-225899304 CCCAGGGCTGGGCCCTCAGTGGG + Intronic
922730430 1:227946520-227946542 CCCAGGGCCGTACCCACAGTTGG + Intronic
922988300 1:229883906-229883928 CCCAGGGAGCTGGGCACAGTGGG + Intergenic
1062968102 10:1625857-1625879 GCCAGGCAGGTGCACACAGAGGG - Intronic
1063969080 10:11368764-11368786 CCCAGGATGGTGTCCACAGCAGG + Intergenic
1066598241 10:37076247-37076269 GCCATGCAGGAGCCCACAGTGGG - Intergenic
1067183278 10:44006266-44006288 CCCAGGGAAGTGCCCCCAGGGGG - Intergenic
1069248910 10:66244483-66244505 TCCAGTGATGTGGCCACAGTGGG + Intronic
1069557873 10:69409184-69409206 CCCTGGGAGGCGCCCAGGGTGGG - Intronic
1069684949 10:70312039-70312061 TCCAGTGTGGTGCCCACAGTGGG + Intronic
1069718042 10:70533118-70533140 CCCATGGAGGTGCTCAGGGTGGG + Intronic
1069901819 10:71710821-71710843 CCCATGGAGTGGCCCACACTGGG + Intronic
1070512239 10:77172014-77172036 CCTAGGGATTTGCACACAGTAGG + Intronic
1072513077 10:96148647-96148669 CCCAAAGAGCTCCCCACAGTGGG - Intronic
1073445883 10:103580057-103580079 CCCAGGGCTGGGCACACAGTAGG + Intronic
1073459698 10:103659585-103659607 CCCAGGGAGGAGCCCAGTGTGGG + Intronic
1075324884 10:121523395-121523417 CCCAGGGACCTGTCCACAGCGGG + Intronic
1075558409 10:123449727-123449749 CCCAAGCAGGTGCCCCCACTGGG - Intergenic
1075742967 10:124706870-124706892 TCCAGGGAGTTGACCACATTTGG - Exonic
1075978643 10:126718535-126718557 CCCAGGAACTTGCCCACAGCTGG - Intergenic
1076503587 10:130956516-130956538 CTCAGGGAGGGGTCCACAGAGGG + Intergenic
1076874925 10:133211224-133211246 GCCAGGGAGGTGCCCAGCCTGGG - Intronic
1076898891 10:133327356-133327378 CCCAGGTGACTGCCCACAGTGGG + Intronic
1077434330 11:2531527-2531549 CCCAGGGATGCGCAGACAGTGGG - Intronic
1078581467 11:12542499-12542521 CCCAGGGATGTCCCCAAAGGTGG + Intergenic
1083151015 11:60791789-60791811 CCCAGGGACTAGCCCATAGTAGG + Intronic
1083842843 11:65314746-65314768 CCCCGGGCGGTGCCCGGAGTGGG + Intergenic
1083897830 11:65629023-65629045 CCCACAGAGGGGCCCACAGCAGG + Intronic
1084174635 11:67416862-67416884 CCCAGGGCTGGGCACACAGTAGG + Intronic
1084180027 11:67441583-67441605 CCCAGGGTGGTGGGCAGAGTGGG - Intronic
1084269854 11:68022964-68022986 CCCAGGAAGCTGCCCACTGAAGG - Intronic
1084322596 11:68381889-68381911 CCAAGGCTGGTGCCCACAGCTGG - Intronic
1084334748 11:68450141-68450163 CGCAGGGATGGGCCCACAGCAGG - Intergenic
1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG + Intergenic
1084653426 11:70502022-70502044 CCGAGGGAGGTGCACACATGGGG + Intronic
1089192322 11:116661971-116661993 CCCAGGGAGGTGATCAGAGCAGG + Intergenic
1089588131 11:119522826-119522848 GCCAGGGAGGTGCCCAGAGGTGG + Intergenic
1089777897 11:120851712-120851734 CTCAGATAGGTTCCCACAGTGGG - Intronic
1090843633 11:130513599-130513621 CCCAGGAACCTGCACACAGTAGG - Intergenic
1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG + Intergenic
1091799896 12:3318301-3318323 CCCAGGGAGCTACCCAGAGAGGG - Intergenic
1093525607 12:20101477-20101499 CAGATGCAGGTGCCCACAGTGGG - Intergenic
1097934128 12:65226030-65226052 CCCAGGGAGAAGCCAAGAGTTGG + Intronic
1099178678 12:79453079-79453101 CCCTGGGAGCAGCCCACAATCGG + Intergenic
1102190026 12:110980762-110980784 CCCAGTGATATGCACACAGTAGG + Intergenic
1102422293 12:112813534-112813556 CCCAGGGAAGTGAACACAGCTGG + Intronic
1103919680 12:124392953-124392975 TCCAGGGAGCGGCCAACAGTGGG - Intronic
1103937641 12:124484980-124485002 TCCAGGGAGGTGAGCACAGAGGG - Intronic
1104372678 12:128237430-128237452 CCCAGGGAGGTGGCCTCCATGGG + Intergenic
1104641163 12:130468342-130468364 CTCAGGGAGGGGCCCAAGGTTGG - Intronic
1105873367 13:24529815-24529837 CCCAGTGAGGTTCACCCAGTGGG - Intergenic
1106419681 13:29575818-29575840 CAGAGGCAGGTGACCACAGTGGG - Intronic
1107814469 13:44232017-44232039 CCCAGGGTGGTAGCCACAGTCGG - Intergenic
1109007803 13:56901015-56901037 GCCATGCAGGAGCCCACAGTGGG - Intergenic
1117066080 14:52014375-52014397 AGCAGGAAGGTGCCCACAGATGG + Exonic
1121041862 14:90756244-90756266 CCCAGAGTGCTGCCCGCAGTTGG - Intronic
1121308876 14:92924024-92924046 CCCTGGTTGCTGCCCACAGTGGG - Intronic
1121576861 14:94995815-94995837 TCCAGGGAGTTACCAACAGTGGG - Intergenic
1121629928 14:95414445-95414467 CCCTGGGAGGTGCCCAGTGGTGG - Intronic
1122343770 14:101045550-101045572 CCTGGAGAGGTGCCCACACTGGG + Intergenic
1122413877 14:101539347-101539369 CCCAAGGAGGTGCCCACCCCCGG - Intergenic
1122719343 14:103713444-103713466 CACAGGGAGCAGCCCACAGCAGG + Intronic
1123217912 14:106829905-106829927 CCCAGGGCTGAGCACACAGTGGG + Intergenic
1123405095 15:20015077-20015099 CCCAGACAGCTGCCCAAAGTTGG - Intergenic
1123514426 15:21021725-21021747 CCCAGACAGCTGCCCAAAGTTGG - Intergenic
1125732194 15:41899267-41899289 CCCAAGCTGGTGCCCACAGAGGG + Exonic
1127782523 15:62329660-62329682 CCCAGTCAGGTGGCCACAGGAGG - Intergenic
1128129438 15:65215825-65215847 CCCACTGAGGAGCCTACAGTTGG - Intergenic
1129832953 15:78682455-78682477 CCCAGGGAGGTGCCTGCAGGAGG + Intronic
1132873129 16:2124379-2124401 CCCTGGGCTCTGCCCACAGTTGG + Intronic
1132896940 16:2233661-2233683 CCCTGGGAGGAGCCCGCAGGTGG - Intronic
1133041071 16:3059896-3059918 CCCAGGGAGGTGCCCAAGTTGGG - Exonic
1133054980 16:3141425-3141447 GCCCGGGAGGTGGCCACAGATGG - Exonic
1134313262 16:13095440-13095462 CCCAGTGAGGTGGCCACACATGG - Intronic
1134552218 16:15143560-15143582 CCCTGGGCTCTGCCCACAGTTGG + Intergenic
1135097906 16:19579707-19579729 CTCAGGGAGGTGACTGCAGTTGG - Intronic
1137766869 16:50984572-50984594 GCCAGTGAGGTGACAACAGTGGG + Intergenic
1138185195 16:54971339-54971361 CCCAGCCAGGGTCCCACAGTGGG - Intergenic
1140067824 16:71625893-71625915 CCAGGGGAGGTGGCCACAGTTGG + Intergenic
1141046841 16:80723094-80723116 CCCAGGGAGGTGCCTGTGGTGGG - Intronic
1141186298 16:81789881-81789903 CCTAGGGCGGCGCCTACAGTGGG - Intronic
1141678661 16:85531210-85531232 CTCAGAGCTGTGCCCACAGTGGG - Intergenic
1141720418 16:85752380-85752402 CCCAGGGATGTGCCCTCAGCAGG - Intergenic
1142411154 16:89917925-89917947 CCCAGGAAGATGCCTGCAGTGGG + Exonic
1145808753 17:27752477-27752499 CCCAGGAATCAGCCCACAGTAGG + Intergenic
1145992055 17:29085260-29085282 GCCAGGGAGGTGGCCACACTTGG + Intronic
1146603048 17:34235130-34235152 CACAGGGCTGTGCACACAGTAGG + Intergenic
1146683003 17:34822118-34822140 GCCAGGGAGGGGCCCTCTGTAGG + Intergenic
1147864447 17:43543489-43543511 CCCTAGGAGCTGCCCACTGTGGG + Intronic
1147884712 17:43676833-43676855 CCCAGGGAGGTGGCAGCAATAGG - Intergenic
1149325974 17:55530281-55530303 CCCAGGGATGTGAAAACAGTTGG + Intergenic
1151368970 17:73635494-73635516 TCCAGGGAGGTGCCCAGGGAAGG + Intronic
1151670657 17:75570143-75570165 GCCAAGGAGGTGACCACAGCCGG - Exonic
1152302798 17:79505289-79505311 CCCAGGCAGGTGCTGGCAGTGGG - Intronic
1152377139 17:79924724-79924746 GCCAGGGAGGGGCCCACATTGGG - Intergenic
1152764283 17:82127654-82127676 CCCCAGGAGCTGCCCACAGCTGG - Intronic
1153621365 18:6981329-6981351 CCCAGGTAGGAGCCCACCCTAGG - Intronic
1153927209 18:9844453-9844475 CCCAGGAAGATGCCCAGAGGTGG - Intronic
1154041270 18:10858731-10858753 CCCAGAAGGGTGCACACAGTGGG + Intronic
1156490764 18:37494679-37494701 CCCTGAGATGTGGCCACAGTGGG + Intronic
1157560176 18:48640056-48640078 CCCAGGCAGCTGCCCACTGAAGG + Intronic
1157578708 18:48760848-48760870 GCCAGGGCTGTGCCCACAGGGGG + Intronic
1160265402 18:77337425-77337447 CCCAGGCAGGTGCACATGGTAGG - Intergenic
1160583745 18:79901545-79901567 CCCACGGAGGGGCCCTCACTGGG + Intergenic
1160848921 19:1180427-1180449 CCGAGGGAGGTGCCCAGGGAGGG + Intronic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161046074 19:2135749-2135771 CCCAGTGAGGTGCTCACACAGGG + Intronic
1161725391 19:5925471-5925493 CCCAAGGTTGTGCCCAGAGTGGG + Intronic
1161742924 19:6035241-6035263 CCCTGGGAGCAGCCCTCAGTGGG - Intronic
1163212924 19:15854759-15854781 GCCAAGGAAGTGCCCACAGGTGG - Intergenic
1163987956 19:20970719-20970741 GCCAGGGCTCTGCCCACAGTAGG + Intergenic
1164041568 19:21497250-21497272 CCCTGGGACTTGTCCACAGTGGG + Intronic
1164281049 19:23769132-23769154 CCCTGGGACCTGTCCACAGTGGG + Intronic
1164311564 19:24050685-24050707 CCCTGGGACCTGTCCACAGTAGG + Intronic
1165074548 19:33273611-33273633 CACAGGGACGTGCCCACACACGG - Intergenic
1166518604 19:43464658-43464680 CGGAAGGATGTGCCCACAGTTGG - Intronic
1166783552 19:45354501-45354523 CTGAGGGAGGGGCCCACATTGGG + Intronic
1166943776 19:46384670-46384692 CCCTGGGAGGTGCTGACAGGAGG + Intronic
1167326926 19:48832441-48832463 CCCAGGGCTGTGCCCTCACTTGG - Intronic
1167567103 19:50263431-50263453 CCTGGGGAGGTGGCCCCAGTAGG + Intronic
1168110722 19:54190154-54190176 CAGAGGGAGGTGCGCTCAGTGGG + Intronic
1168445073 19:56404421-56404443 CCGAAGGAGGTGCCCACTGGAGG + Exonic
925070128 2:960275-960297 CCCTGGTAGGATCCCACAGTGGG + Intronic
925098561 2:1227295-1227317 CCCTGGAAAGTGCACACAGTAGG - Intronic
927324145 2:21783711-21783733 CTCAGTGAGTTGCACACAGTAGG - Intergenic
928327823 2:30334026-30334048 CCCAGGCAGGCACCCACAGTTGG + Intergenic
931706667 2:64951886-64951908 GGCAGGCAGGTGCTCACAGTTGG + Intergenic
932323284 2:70837630-70837652 CCCAGAGAGGACCCCACACTGGG + Intergenic
933055677 2:77660769-77660791 CCCAGGAAGATTCCCACAGCTGG + Intergenic
934513026 2:94963357-94963379 CCCAGGGATGAGCACACAGGAGG + Intergenic
936379003 2:111967796-111967818 CCCAGCCAGGTGCACACAGTAGG + Intronic
936448994 2:112619303-112619325 CCCAGAAAGGTGCCTACTGTAGG + Intergenic
939999350 2:148951347-148951369 CCCTGGGAGGTGTCCATAGGTGG + Intronic
941421516 2:165287712-165287734 CCCAAAGAGGTGTCCCCAGTGGG - Intronic
945631738 2:212286976-212286998 ACCAGGGAGGGGCCCAAGGTAGG + Intronic
946361211 2:219220290-219220312 CCAAGGGAGGTGCCAACACTGGG - Exonic
948059312 2:235031740-235031762 CCCAGAGAGCTGCCCATAGAGGG - Intronic
948615115 2:239193502-239193524 CCAGGGGAAGGGCCCACAGTGGG + Intronic
949050275 2:241894263-241894285 CCCAGGGAGATGCCCAGACAGGG - Exonic
1169196832 20:3687736-3687758 CTCAGGGATGAGCTCACAGTTGG + Exonic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1170667084 20:18395549-18395571 CCCAGCAAAGTGCCCTCAGTAGG + Intronic
1171798061 20:29581834-29581856 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1172225752 20:33304258-33304280 GCCTGGGAGGTGTCCAGAGTGGG - Intronic
1173148965 20:40549678-40549700 CCCTGGGAGGTGACCTCAGGTGG + Intergenic
1174276946 20:49410741-49410763 CCCAAGAGGTTGCCCACAGTTGG + Intronic
1175251564 20:57613122-57613144 CCCAGGGAGGGGACCTCGGTGGG - Intronic
1175413307 20:58785477-58785499 TCCAGGGAAATGCCCACACTGGG - Intergenic
1175904415 20:62372460-62372482 CTCCAGGAGGTGCCCACAGACGG + Intergenic
1176008001 20:62876650-62876672 CCCAGGGAGGAGGCGGCAGTGGG - Intergenic
1176640855 21:9302421-9302443 CCCAGGGAGTTTCCCAAAATCGG - Intergenic
1178677926 21:34646859-34646881 CCCAAGGGGCTGCCCACTGTGGG - Intergenic
1179133501 21:38660325-38660347 CCCAGGGAGGCGCGTGCAGTCGG - Intronic
1180057517 21:45366659-45366681 TCCAGGGAGGTGCTCCCACTGGG + Intergenic
1180726565 22:17950982-17951004 CCCAGGGTGGGGCTGACAGTGGG - Intronic
1181036331 22:20171539-20171561 CCCAGCCAGGAGCCCACAGGAGG - Intergenic
1181804030 22:25364488-25364510 CCAAGGCTGGTGCCCACAGCTGG + Intronic
1182283586 22:29231632-29231654 CCAAGGGAGATGCCGGCAGTCGG + Exonic
1182361232 22:29747683-29747705 TCCCGGGAGGTGCCCAGAGAGGG - Intronic
1182554743 22:31123085-31123107 CCCAGGGTGTTGCCCAAACTGGG + Exonic
1183352372 22:37341431-37341453 CCCAGGCGGGTGAGCACAGTGGG - Intergenic
1184433840 22:44458234-44458256 CACAGGGAGATGCTCCCAGTGGG - Intergenic
1184799342 22:46750502-46750524 CTCAGGGAGGGGCCCACAGGAGG + Intergenic
1185111900 22:48904976-48904998 CCATGGGAGGTGCCCACATCAGG - Intergenic
1185111917 22:48905041-48905063 CCATGGGAGGTGCCCACATCAGG - Intergenic
1185111965 22:48905236-48905258 CCATGGGAGGTGCCCACATCAGG - Intergenic
950672920 3:14537958-14537980 CCCAGGCTGGGGCACACAGTAGG - Intronic
952827687 3:37537799-37537821 CTCCTGGAGGAGCCCACAGTCGG - Intronic
952889291 3:38029923-38029945 CCCAGCGAGGCGCCCACAACAGG - Intergenic
953914024 3:46906562-46906584 CCCTGGGAGGTGGCCAGAGGGGG + Intergenic
954181053 3:48881582-48881604 TCCAGGGAGGTGAACACAGCAGG + Intronic
954443993 3:50536811-50536833 CACAGGCAGGTGCCCACTGAAGG - Intergenic
954525856 3:51270678-51270700 GCCAGGGAGGAGCCCACCGAAGG + Intronic
954639720 3:52090766-52090788 CCCAGGGATGGGCGCTCAGTAGG - Intronic
954684183 3:52361595-52361617 CAGAGGGAGGTGCCCAGATTGGG + Intronic
961619044 3:128208749-128208771 CCCAGTGAGATGGCCACATTGGG + Intronic
961815481 3:129548004-129548026 CTCAGGGAGGTGCCAGCAGAGGG - Intronic
961997515 3:131261595-131261617 CCCAGGGAGGTGGCCTGAGCTGG + Intronic
963554653 3:146772444-146772466 CCCAGGGCGGTGGCCCCAGCCGG - Intergenic
964242811 3:154616306-154616328 CTCAGGGATGTGCCCACTGTAGG - Intergenic
964375086 3:156041562-156041584 GCCACGCAGGAGCCCACAGTGGG - Intronic
964475814 3:157096678-157096700 TGCAGGGAGCTGCGCACAGTGGG + Intergenic
968572264 4:1347944-1347966 CCCAGAGAGGCACCCACAGATGG + Intronic
969613911 4:8241506-8241528 GCCAGGAAGGTGCCCCCATTAGG + Intronic
972580981 4:40395475-40395497 CCAAGGATGGTGGCCACAGTTGG - Intergenic
972686607 4:41359368-41359390 CCCGTGGAGGAGCCCACAGCGGG - Intergenic
977249117 4:94669385-94669407 CCCTGGGAGGCTCCCACACTTGG - Intergenic
979231943 4:118356070-118356092 CCCAGGGAGGCCCCCATAATGGG + Intergenic
979698446 4:123640524-123640546 CCCAAGGAGGTGAACACAGGTGG - Intergenic
985593068 5:775290-775312 CCCAGGCAGGTGCCCATGGTGGG + Intergenic
985610372 5:884669-884691 CCCAGGCAAGTGCCCAGGGTGGG - Intronic
985757972 5:1730474-1730496 CCAGGGGAGGTGACCACAGAGGG + Intergenic
985851114 5:2389655-2389677 CCCAGGCACATGCCCACAGCAGG + Intergenic
986402042 5:7392307-7392329 CCCTGAGAGGTGACCACATTAGG + Intergenic
989606248 5:43246815-43246837 CTTGGGGAAGTGCCCACAGTGGG - Intronic
989780729 5:45262156-45262178 GCCAGGGACTCGCCCACAGTGGG + Exonic
992772365 5:80060380-80060402 CCCAGGGAGGGCCCCAGAGGAGG + Intronic
992789540 5:80201208-80201230 CTGATGGAGCTGCCCACAGTAGG - Intronic
993075941 5:83231404-83231426 CCCAGTGCTGTGCACACAGTAGG + Intronic
995112344 5:108442155-108442177 GCCATGCAGGAGCCCACAGTGGG + Intergenic
997803257 5:136888367-136888389 CCCGTGGTGGTTCCCACAGTTGG + Intergenic
998204330 5:140148250-140148272 CCCAGGGCGTAGCACACAGTAGG - Intergenic
999299389 5:150481816-150481838 CCCAGGGAGGTGGCTGCCGTGGG - Intergenic
1001664507 5:173421379-173421401 CCCAGAGAGGCCCACACAGTGGG - Intergenic
1002096695 5:176835372-176835394 CCCAGGAAGGTTCCCAGAGGGGG + Intronic
1004549215 6:16630155-16630177 CCCAAGGGAATGCCCACAGTTGG - Intronic
1004886188 6:20053698-20053720 CCCAGGAAGGTGCCACCAGCGGG - Intergenic
1007725076 6:43911243-43911265 CCCGGGGCTGTGCACACAGTAGG + Intergenic
1010036728 6:71334101-71334123 CCCAGCCAGGTGTTCACAGTAGG - Intergenic
1011111781 6:83846025-83846047 ACCAGGAAGGTGCTCACAGATGG - Intergenic
1013732488 6:113184967-113184989 TCCAGGGAAGAGACCACAGTGGG + Intergenic
1015948966 6:138532175-138532197 CCAAGGAAGGTGAACACAGTGGG + Intronic
1017102908 6:150864560-150864582 CCCTGTGAGGTGCCCTGAGTTGG + Intergenic
1018228579 6:161654664-161654686 ACGTGGGAGGTGCACACAGTAGG - Intronic
1018713685 6:166515325-166515347 CCCCGGGAGGGGCCCGCAGCTGG + Intronic
1019257366 7:60891-60913 CCCAGGGCAGGGCCCACGGTGGG + Intergenic
1019557351 7:1639310-1639332 CCCAGGGAGAGACCCACAGATGG - Intergenic
1019605992 7:1910507-1910529 CCCAGGGCAGTGCCCAGCGTGGG - Intronic
1019912778 7:4110818-4110840 CCCAGGCAGGTGCCTTCTGTTGG + Intronic
1019916998 7:4140070-4140092 CCCAGGGAGGTGGTGACAGGGGG - Intronic
1023855776 7:44182860-44182882 GCCAGTGAGGTGCCAACAGCAGG - Intronic
1024221809 7:47294663-47294685 CCCAGTGCCTTGCCCACAGTAGG + Intronic
1026788753 7:73318569-73318591 CCCAAGCAGCTGCCCACAGCTGG - Intronic
1026901395 7:74039415-74039437 CCCAGGGAGGCCCCCACATCCGG + Intronic
1032003448 7:128281778-128281800 CTGAGGGAGGAGACCACAGTTGG + Intergenic
1032467806 7:132157486-132157508 CCCATGGAGGGGCTCACAGAAGG - Intronic
1032854471 7:135822863-135822885 CATAGAGAGGCGCCCACAGTGGG - Intergenic
1033048849 7:137986119-137986141 CTCAGAAAGGTGCTCACAGTAGG + Intronic
1033548659 7:142425536-142425558 CCCAGGGTGGGGCCCAGACTTGG - Intergenic
1035314694 7:157990621-157990643 CTCAGGGCGGTGCTGACAGTAGG + Intronic
1040983901 8:53272328-53272350 CCCAGGGAAGTGGCCAGAGATGG - Intergenic
1041255998 8:55980058-55980080 CCCCGGGAGGTGGCCACACAGGG + Intronic
1042867085 8:73365730-73365752 CCACGGGAGGTGCCCCCACTGGG - Intergenic
1043415875 8:80048498-80048520 CCCATGGAGGTGGATACAGTAGG - Intronic
1043745416 8:83868950-83868972 CCCAGGGAGGTGGGCTCAGGGGG - Intergenic
1045387984 8:101689654-101689676 CCCAGGGCCGGGCACACAGTGGG - Intronic
1048472179 8:134713213-134713235 CCCAGGGAGGGGCCCTCGGGAGG + Intergenic
1048979565 8:139695904-139695926 CCCAGGGAGCTGGCCCCAGAGGG - Intronic
1049394837 8:142395159-142395181 CACAGGAAAATGCCCACAGTGGG - Intronic
1049682531 8:143926073-143926095 CCCAGGCTGGTGAGCACAGTGGG - Intronic
1052338260 9:27340838-27340860 CCCATGGAGGTCTGCACAGTTGG + Intronic
1052851597 9:33381578-33381600 ACCAGGGAAGGGCCCACAGCTGG - Intergenic
1053123471 9:35562207-35562229 CCGAGGTAGCTACCCACAGTGGG - Intronic
1053289119 9:36868434-36868456 GCCCGGGGGGTGCACACAGTGGG + Intronic
1053787955 9:41665620-41665642 CCCAGGGAAAGGCCCACAGAGGG + Intergenic
1054109914 9:61096969-61096991 CCCTCCGAGGTGCCCCCAGTGGG - Intergenic
1054157176 9:61649148-61649170 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1054176231 9:61876962-61876984 CCCAGGGAAAGGCCCACAGAGGG + Intergenic
1054476951 9:65580153-65580175 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1054610943 9:67234156-67234178 CCCTCCGAGGTGCCCCCAGTGGG + Intergenic
1054661308 9:67703846-67703868 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1055539100 9:77282687-77282709 CCCAGGGAGGTGAGCGCTGTGGG + Intronic
1056035526 9:82600896-82600918 CCCAGAGAGGCCTCCACAGTTGG + Intergenic
1056552451 9:87663421-87663443 ATCAGGGAGGGGCTCACAGTGGG - Intronic
1059307873 9:113368799-113368821 CACAGGGTGGGGCCCACAGTTGG - Intronic
1061039983 9:128135668-128135690 CCCAGGGAGGTACCAGGAGTAGG + Intergenic
1061365485 9:130170849-130170871 AGCAGTGAGGGGCCCACAGTGGG - Intergenic
1061970206 9:134040896-134040918 CCCATGGAGGTGGCTGCAGTGGG - Intronic
1061971388 9:134047324-134047346 CCCAGGGACGTGCAGGCAGTTGG - Intronic
1062058814 9:134483535-134483557 GCCAGTGAGGTGCACAGAGTGGG - Intergenic
1062077866 9:134601829-134601851 CCCAGCGAGCTGCCTGCAGTGGG + Intergenic
1062282645 9:135758913-135758935 CACAGGCAGGTGGGCACAGTGGG - Intronic
1203793573 EBV:164194-164216 CTTAGGGAGGTGGCCACACTGGG - Intergenic
1185790202 X:2923567-2923589 CCCAGGGTGGTGGCCTCAGGAGG - Intronic
1187366483 X:18669795-18669817 CCCAGGGTAGGGCACACAGTAGG + Intronic
1187398523 X:18939075-18939097 CCCGAGGAGGAGGCCACAGTCGG + Intronic
1194738158 X:97539299-97539321 CCCAGAGAGGTCTCCACAGAAGG + Intronic
1197728611 X:129792657-129792679 CCCAGCCACGTGCCCACAGGTGG - Exonic
1198663403 X:138996101-138996123 CCCAGTGAGATACCCACAGAAGG + Intronic
1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG + Intronic
1199834393 X:151574203-151574225 CCTGGCTAGGTGCCCACAGTTGG - Intronic
1201491819 Y:14549905-14549927 CCCAGGGAAGTCTCCACTGTTGG - Intronic
1201730861 Y:17201348-17201370 GCCAGTTTGGTGCCCACAGTGGG + Intergenic