ID: 903463471

View in Genome Browser
Species Human (GRCh38)
Location 1:23535422-23535444
Sequence TGTATGTAAAATACCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903463471_903463479 26 Left 903463471 1:23535422-23535444 CCCAGCTAGGTATTTTACATACA No data
Right 903463479 1:23535471-23535493 CCTGTAACACAGGTACATTTTGG No data
903463471_903463474 16 Left 903463471 1:23535422-23535444 CCCAGCTAGGTATTTTACATACA No data
Right 903463474 1:23535461-23535483 TCCCAACTACCCTGTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903463471 Original CRISPR TGTATGTAAAATACCTAGCT GGG (reversed) Intergenic
No off target data available for this crispr