ID: 903464944

View in Genome Browser
Species Human (GRCh38)
Location 1:23545445-23545467
Sequence CTGCTGGGACAGAGGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903464932_903464944 4 Left 903464932 1:23545418-23545440 CCTGCTCTGTGAACCCCTGGACC No data
Right 903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG No data
903464935_903464944 -9 Left 903464935 1:23545431-23545453 CCCCTGGACCCCAGCTGCTGGGA No data
Right 903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG No data
903464936_903464944 -10 Left 903464936 1:23545432-23545454 CCCTGGACCCCAGCTGCTGGGAC No data
Right 903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG No data
903464930_903464944 13 Left 903464930 1:23545409-23545431 CCATGAGTGCCTGCTCTGTGAAC No data
Right 903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903464944 Original CRISPR CTGCTGGGACAGAGGGAGTT GGG Intergenic
No off target data available for this crispr