ID: 903466574

View in Genome Browser
Species Human (GRCh38)
Location 1:23556138-23556160
Sequence AAATGCATCACACACCTACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903466574_903466578 12 Left 903466574 1:23556138-23556160 CCTCGTAGGTGTGTGATGCATTT 0: 1
1: 0
2: 0
3: 2
4: 79
Right 903466578 1:23556173-23556195 CCACCATTATCTTCTGTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 174
903466574_903466580 15 Left 903466574 1:23556138-23556160 CCTCGTAGGTGTGTGATGCATTT 0: 1
1: 0
2: 0
3: 2
4: 79
Right 903466580 1:23556176-23556198 CCATTATCTTCTGTCCTGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 249
903466574_903466576 11 Left 903466574 1:23556138-23556160 CCTCGTAGGTGTGTGATGCATTT 0: 1
1: 0
2: 0
3: 2
4: 79
Right 903466576 1:23556172-23556194 CCCACCATTATCTTCTGTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 139
903466574_903466582 23 Left 903466574 1:23556138-23556160 CCTCGTAGGTGTGTGATGCATTT 0: 1
1: 0
2: 0
3: 2
4: 79
Right 903466582 1:23556184-23556206 TTCTGTCCTGGGAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 45
4: 380
903466574_903466581 22 Left 903466574 1:23556138-23556160 CCTCGTAGGTGTGTGATGCATTT 0: 1
1: 0
2: 0
3: 2
4: 79
Right 903466581 1:23556183-23556205 CTTCTGTCCTGGGAGGCAGCAGG 0: 1
1: 1
2: 5
3: 47
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903466574 Original CRISPR AAATGCATCACACACCTACG AGG (reversed) Intergenic
903466574 1:23556138-23556160 AAATGCATCACACACCTACGAGG - Intergenic
907269335 1:53281457-53281479 AGATGCATCTCAGACCTCCGTGG + Intronic
912711056 1:111950230-111950252 GAATGCATCACACTCATAAGGGG - Intronic
917148839 1:171923641-171923663 AAATGGATCAAAGACCTAAGTGG - Intronic
1063440993 10:6072921-6072943 AAATTCATCCCACACCCACCAGG - Intergenic
1066717720 10:38304937-38304959 CAATGCTTCACACACCCACTGGG - Intergenic
1070248910 10:74756474-74756496 AGATTCATCACACACATAGGTGG + Intergenic
1078736881 11:14028595-14028617 ATATGCATCAATCACCTACTAGG + Intronic
1091270779 11:134310427-134310449 ACTGGCATCACACACCCACGTGG + Intronic
1098621469 12:72605761-72605783 AAATGCATGACACACATAGAAGG + Intronic
1114653388 14:24300720-24300742 AAAATCATCACACACCTCAGCGG - Exonic
1114973542 14:28065174-28065196 AAATGCAGCCTACACCTAAGTGG + Intergenic
1115712790 14:36069138-36069160 AAATGCATGAGTCACCTACTGGG + Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1135604985 16:23816257-23816279 GAAAGCACCACACACCTATGAGG - Intergenic
1138724531 16:59120988-59121010 AGATGCCTCACAGACCTACAGGG - Intergenic
1139066770 16:63325385-63325407 AAATGAATCAGAGACCTAAGAGG + Intergenic
1140334263 16:74089625-74089647 AACTGCCTGACACACCTCCGTGG - Intergenic
1144191074 17:12846480-12846502 AAAAGCACAACACACCTACATGG - Intronic
1149159177 17:53669447-53669469 TAATGTATCACACAACTAAGAGG + Intergenic
1159222914 18:65488612-65488634 CAATGTATCACACTCCCACGTGG - Intergenic
1163295494 19:16409347-16409369 AAATGGATCAAAGACCTACATGG + Intronic
1167718286 19:51158581-51158603 AAATGCATCACACCACCAGGGGG + Intergenic
925428871 2:3774014-3774036 AAATGCATTACACCCCTTGGAGG - Intronic
925639829 2:5976761-5976783 AAATGCATCACATACAAAGGAGG - Intergenic
929387811 2:41431902-41431924 TAATGCATCACACACATAAAAGG + Intergenic
930618575 2:53620675-53620697 AAATGCATCACCCACCTTTCAGG + Intronic
931206842 2:60155510-60155532 AAATGCATCACACTCCAATTGGG - Intergenic
933918770 2:87023362-87023384 TAATGCATCTAACACCTACCAGG - Intergenic
934004224 2:87746552-87746574 TAATGCATCCAACACCTACCAGG + Intergenic
935348108 2:102127441-102127463 AAATGCATCTACCACCTACTAGG + Intronic
941389078 2:164889496-164889518 AAATGCATCAAACCCATACTGGG - Intergenic
946593053 2:221272665-221272687 AAATACATCACAGACATATGAGG - Intergenic
1169561125 20:6802220-6802242 AAATACAACACACACCAAAGTGG + Intergenic
1169719359 20:8656991-8657013 ACATTCATAACACACCTATGAGG - Intronic
1170636424 20:18109120-18109142 AAATGCATCATAGACCTGCCAGG - Intergenic
1174282259 20:49447743-49447765 AAATAGATCACAGACCTACTAGG - Intronic
1178971296 21:37179558-37179580 AAATGGATCACAGACCTAAATGG - Intronic
1179362229 21:40721099-40721121 AAATGTATCACACAGCTGCAGGG + Intronic
1180191156 21:46163487-46163509 AAATGGATCAAAGACCTAAGAGG - Intronic
1181885624 22:26020007-26020029 CACTACATCACACACCTACTGGG - Intronic
1184396120 22:44242391-44242413 AAATGGATCATAGACCTAAGTGG - Intergenic
951272216 3:20640077-20640099 AAATGAATCACAGAACTATGAGG - Intergenic
952245388 3:31584058-31584080 AAATGGATCAAAGACCTAAGTGG - Intronic
953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG + Intronic
954981061 3:54745596-54745618 AATTGCATCACACACCTTTAAGG + Intronic
955124446 3:56097006-56097028 AAATTCAACACACACCTTAGTGG - Intronic
967302953 3:188034447-188034469 AAATGGATCACAGACCTAAATGG + Intergenic
971632659 4:29014013-29014035 AAATGCATTCCTCACCTACCAGG + Intergenic
972440254 4:39081840-39081862 ACATGCATTACAGACCTACATGG - Intronic
974066130 4:57079114-57079136 AAAAGCAGCACACATCTACTTGG + Intronic
974906996 4:68070442-68070464 AAATGCATCACAGACCCCTGAGG + Intronic
982250925 4:153405745-153405767 AAATGGATCAAAGACCTACATGG + Intronic
984311015 4:178058322-178058344 AAATGAACCAGAAACCTACGTGG + Intergenic
990917043 5:60918790-60918812 GAATGCCTCACACACCTCCATGG + Intronic
994608352 5:102000832-102000854 AAATGCATTATATACCTACAAGG - Intergenic
995305292 5:110639833-110639855 ATAGGCTTCACACACCTATGAGG + Intronic
1005462342 6:26081008-26081030 AAATCCATACCACACCTACATGG - Intergenic
1009589966 6:65655268-65655290 ATATGCATCTCACACTTAAGTGG - Intronic
1010956698 6:82098446-82098468 TAATGAATAACACACCTACAAGG - Intergenic
1019156362 6:170041575-170041597 AAATGCTTCTCACACCTTCCTGG - Intergenic
1020500352 7:8911221-8911243 AAATACATCACACACATACTTGG + Intergenic
1021324501 7:19249131-19249153 AAATGTATAACACACCCAGGTGG + Intergenic
1027796820 7:82705428-82705450 AAATGAATTACACACCTACATGG - Intergenic
1027879172 7:83811528-83811550 AAATACATCACACAGATATGTGG + Intergenic
1029254639 7:99261344-99261366 AGATGCACCAGACACCCACGTGG - Intergenic
1035711129 8:1715370-1715392 AACTGCACCACACAACTACATGG + Intergenic
1035998926 8:4580117-4580139 AAATGTATTAAACACCTATGTGG + Intronic
1038419893 8:27427067-27427089 GGATGCATCACCCACCCACGGGG - Intronic
1049315195 8:141962261-141962283 AAGTGCAGCACCCAACTACGAGG + Intergenic
1051056691 9:12995424-12995446 AAATGGACCATACACCTAGGTGG + Intergenic
1052164975 9:25314983-25315005 AAATTCATCACATACCTAAATGG + Intergenic
1057698774 9:97348076-97348098 ACATGCATTTCACACCTATGTGG + Intronic
1058075982 9:100651746-100651768 AAATACACGATACACCTACGAGG - Intergenic
1059125315 9:111679185-111679207 AAATGCATGACATAACTAAGAGG + Intergenic
1060073212 9:120569017-120569039 ACATGTATTACACACCTACTCGG + Intronic
1060496697 9:124124726-124124748 AAATGCATGACACTCCTGCTGGG - Intergenic
1062733740 9:138123045-138123067 AAATGCCTCACACAAGCACGTGG - Exonic
1185785794 X:2889958-2889980 GAATGCCTCACACACCTCCTGGG + Intergenic
1187312335 X:18157068-18157090 AAATGCATCACACAAATTAGAGG - Intergenic
1192325385 X:70127910-70127932 AAAGCCATCACACACCTATTAGG + Intergenic
1201288063 Y:12395862-12395884 GAATGCCTCACACACCTCCTGGG - Intergenic