ID: 903468441

View in Genome Browser
Species Human (GRCh38)
Location 1:23568382-23568404
Sequence CCGAACAGCCACATTCCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903468441_903468446 -9 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468446 1:23568396-23568418 GCTGTTCGGACCGCCGCGGCGGG No data
903468441_903468450 3 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468450 1:23568408-23568430 GCCGCGGCGGGGCCAGGCGCCGG No data
903468441_903468458 30 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468458 1:23568435-23568457 AGGGTCCGCACCTCCCCCGCTGG No data
903468441_903468452 4 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468452 1:23568409-23568431 CCGCGGCGGGGCCAGGCGCCGGG No data
903468441_903468453 7 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468453 1:23568412-23568434 CGGCGGGGCCAGGCGCCGGGAGG No data
903468441_903468455 11 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468455 1:23568416-23568438 GGGGCCAGGCGCCGGGAGGAGGG No data
903468441_903468448 -3 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468448 1:23568402-23568424 CGGACCGCCGCGGCGGGGCCAGG No data
903468441_903468447 -8 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468447 1:23568397-23568419 CTGTTCGGACCGCCGCGGCGGGG No data
903468441_903468454 10 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468454 1:23568415-23568437 CGGGGCCAGGCGCCGGGAGGAGG No data
903468441_903468445 -10 Left 903468441 1:23568382-23568404 CCCGAAGGAATGTGGCTGTTCGG No data
Right 903468445 1:23568395-23568417 GGCTGTTCGGACCGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903468441 Original CRISPR CCGAACAGCCACATTCCTTC GGG (reversed) Intergenic
No off target data available for this crispr