ID: 903468824

View in Genome Browser
Species Human (GRCh38)
Location 1:23570746-23570768
Sequence CTCATCTGGGCTGGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903468824_903468834 14 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468834 1:23570783-23570805 AGACAGGGCAGGAGAAAGACTGG No data
903468824_903468837 22 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468837 1:23570791-23570813 CAGGAGAAAGACTGGAGGGAAGG No data
903468824_903468839 24 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468839 1:23570793-23570815 GGAGAAAGACTGGAGGGAAGGGG No data
903468824_903468832 -1 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468832 1:23570768-23570790 GATTTTGGTACGTGAAGACAGGG No data
903468824_903468840 25 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468824_903468835 17 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468835 1:23570786-23570808 CAGGGCAGGAGAAAGACTGGAGG No data
903468824_903468831 -2 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468831 1:23570767-23570789 AGATTTTGGTACGTGAAGACAGG No data
903468824_903468838 23 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468838 1:23570792-23570814 AGGAGAAAGACTGGAGGGAAGGG No data
903468824_903468833 3 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468833 1:23570772-23570794 TTGGTACGTGAAGACAGGGCAGG No data
903468824_903468836 18 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468836 1:23570787-23570809 AGGGCAGGAGAAAGACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903468824 Original CRISPR CTCATCTGGGCTGGGCATGG TGG (reversed) Intergenic
No off target data available for this crispr