ID: 903468825

View in Genome Browser
Species Human (GRCh38)
Location 1:23570749-23570771
Sequence AATCTCATCTGGGCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903468825_903468840 22 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468825_903468839 21 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468839 1:23570793-23570815 GGAGAAAGACTGGAGGGAAGGGG No data
903468825_903468838 20 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468838 1:23570792-23570814 AGGAGAAAGACTGGAGGGAAGGG No data
903468825_903468836 15 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468836 1:23570787-23570809 AGGGCAGGAGAAAGACTGGAGGG No data
903468825_903468832 -4 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468832 1:23570768-23570790 GATTTTGGTACGTGAAGACAGGG No data
903468825_903468833 0 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468833 1:23570772-23570794 TTGGTACGTGAAGACAGGGCAGG No data
903468825_903468831 -5 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468831 1:23570767-23570789 AGATTTTGGTACGTGAAGACAGG No data
903468825_903468834 11 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468834 1:23570783-23570805 AGACAGGGCAGGAGAAAGACTGG No data
903468825_903468837 19 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468837 1:23570791-23570813 CAGGAGAAAGACTGGAGGGAAGG No data
903468825_903468835 14 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468835 1:23570786-23570808 CAGGGCAGGAGAAAGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903468825 Original CRISPR AATCTCATCTGGGCTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr