ID: 903468827

View in Genome Browser
Species Human (GRCh38)
Location 1:23570754-23570776
Sequence ACCAAAATCTCATCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903468827_903468834 6 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468834 1:23570783-23570805 AGACAGGGCAGGAGAAAGACTGG No data
903468827_903468831 -10 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468831 1:23570767-23570789 AGATTTTGGTACGTGAAGACAGG No data
903468827_903468840 17 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468827_903468838 15 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468838 1:23570792-23570814 AGGAGAAAGACTGGAGGGAAGGG No data
903468827_903468835 9 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468835 1:23570786-23570808 CAGGGCAGGAGAAAGACTGGAGG No data
903468827_903468839 16 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468839 1:23570793-23570815 GGAGAAAGACTGGAGGGAAGGGG No data
903468827_903468833 -5 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468833 1:23570772-23570794 TTGGTACGTGAAGACAGGGCAGG No data
903468827_903468832 -9 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468832 1:23570768-23570790 GATTTTGGTACGTGAAGACAGGG No data
903468827_903468841 27 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468841 1:23570804-23570826 GGAGGGAAGGGGGCAGAGAATGG No data
903468827_903468836 10 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468836 1:23570787-23570809 AGGGCAGGAGAAAGACTGGAGGG No data
903468827_903468837 14 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468837 1:23570791-23570813 CAGGAGAAAGACTGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903468827 Original CRISPR ACCAAAATCTCATCTGGGCT GGG (reversed) Intergenic
No off target data available for this crispr