ID: 903468829

View in Genome Browser
Species Human (GRCh38)
Location 1:23570759-23570781
Sequence CACGTACCAAAATCTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903468829_903468836 5 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468836 1:23570787-23570809 AGGGCAGGAGAAAGACTGGAGGG No data
903468829_903468838 10 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468838 1:23570792-23570814 AGGAGAAAGACTGGAGGGAAGGG No data
903468829_903468841 22 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468841 1:23570804-23570826 GGAGGGAAGGGGGCAGAGAATGG No data
903468829_903468840 12 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468829_903468837 9 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468837 1:23570791-23570813 CAGGAGAAAGACTGGAGGGAAGG No data
903468829_903468839 11 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468839 1:23570793-23570815 GGAGAAAGACTGGAGGGAAGGGG No data
903468829_903468834 1 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468834 1:23570783-23570805 AGACAGGGCAGGAGAAAGACTGG No data
903468829_903468835 4 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468835 1:23570786-23570808 CAGGGCAGGAGAAAGACTGGAGG No data
903468829_903468833 -10 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468833 1:23570772-23570794 TTGGTACGTGAAGACAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903468829 Original CRISPR CACGTACCAAAATCTCATCT GGG (reversed) Intergenic
No off target data available for this crispr