ID: 903468840

View in Genome Browser
Species Human (GRCh38)
Location 1:23570794-23570816
Sequence GAGAAAGACTGGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903468824_903468840 25 Left 903468824 1:23570746-23570768 CCACCATGCCCAGCCCAGATGAG No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468828_903468840 16 Left 903468828 1:23570755-23570777 CCAGCCCAGATGAGATTTTGGTA No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468825_903468840 22 Left 903468825 1:23570749-23570771 CCATGCCCAGCCCAGATGAGATT No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468829_903468840 12 Left 903468829 1:23570759-23570781 CCCAGATGAGATTTTGGTACGTG No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468830_903468840 11 Left 903468830 1:23570760-23570782 CCAGATGAGATTTTGGTACGTGA No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data
903468827_903468840 17 Left 903468827 1:23570754-23570776 CCCAGCCCAGATGAGATTTTGGT No data
Right 903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903468840 Original CRISPR GAGAAAGACTGGAGGGAAGG GGG Intergenic
No off target data available for this crispr