ID: 903469429

View in Genome Browser
Species Human (GRCh38)
Location 1:23575566-23575588
Sequence GAGGGTGTCACAAGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903469429_903469443 22 Left 903469429 1:23575566-23575588 CCCTCCACTCTTGTGACACCCTC No data
Right 903469443 1:23575611-23575633 TGGGGCTTGCTGAGAGAGCCGGG No data
903469429_903469438 4 Left 903469429 1:23575566-23575588 CCCTCCACTCTTGTGACACCCTC No data
Right 903469438 1:23575593-23575615 CAGTTTCCTTCACAGCCCTGGGG No data
903469429_903469437 3 Left 903469429 1:23575566-23575588 CCCTCCACTCTTGTGACACCCTC No data
Right 903469437 1:23575592-23575614 CCAGTTTCCTTCACAGCCCTGGG No data
903469429_903469442 21 Left 903469429 1:23575566-23575588 CCCTCCACTCTTGTGACACCCTC No data
Right 903469442 1:23575610-23575632 CTGGGGCTTGCTGAGAGAGCCGG No data
903469429_903469435 2 Left 903469429 1:23575566-23575588 CCCTCCACTCTTGTGACACCCTC No data
Right 903469435 1:23575591-23575613 CCCAGTTTCCTTCACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903469429 Original CRISPR GAGGGTGTCACAAGAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr