ID: 903474111

View in Genome Browser
Species Human (GRCh38)
Location 1:23607599-23607621
Sequence CAGTCTGAGCTGGGTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903474101_903474111 27 Left 903474101 1:23607549-23607571 CCTTGGCTCTGCTGCATTTGAAC 0: 1
1: 0
2: 0
3: 23
4: 220
Right 903474111 1:23607599-23607621 CAGTCTGAGCTGGGTGACTCTGG 0: 1
1: 0
2: 2
3: 20
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903474111 Original CRISPR CAGTCTGAGCTGGGTGACTC TGG Intronic
900291836 1:1926986-1927008 CGCTCTGAGCAGGGTGGCTCGGG + Exonic
900820160 1:4880368-4880390 TGCTCAGAGCTGGGTGACTCGGG + Intergenic
900973054 1:6002055-6002077 CAGGCTGAGCTGGGGGACAGAGG - Intronic
901090405 1:6637129-6637151 CAGGCTGGGCGCGGTGACTCAGG - Intronic
902695097 1:18134804-18134826 CGGTCTGAGCAGGTTGAGTCGGG - Intronic
903192553 1:21664998-21665020 CAGTCTCTGCTGTGTGACTTTGG - Intronic
903474111 1:23607599-23607621 CAGTCTGAGCTGGGTGACTCTGG + Intronic
903918073 1:26779095-26779117 GAGTATGAGGTGGGTGACCCAGG + Exonic
904345736 1:29867738-29867760 GAGGCTTAGCTGGGTGAATCTGG + Intergenic
906686736 1:47767795-47767817 CAGGCTGCCCTGGGTCACTCCGG + Intronic
907789363 1:57646888-57646910 CAGTCTGTGCTGGGTGAGAAGGG - Intronic
908339601 1:63162934-63162956 CAGTCTGTGATGGGTGACAGAGG - Intergenic
908401051 1:63773662-63773684 CACTGTTAGCTGTGTGACTCTGG - Intergenic
910140128 1:84018125-84018147 TAGTCTGAGCTTGTTGACTTGGG + Intergenic
912707684 1:111927146-111927168 CATTCCCAGCTGTGTGACTCAGG - Intronic
917977833 1:180251445-180251467 CATTCTGTGCTGGGTCACCCGGG - Intronic
918075716 1:181169907-181169929 CACTGGGAGCTGGGTGTCTCAGG - Intergenic
918987077 1:191645495-191645517 CAATCAGAGCTTGGTGACACAGG + Intergenic
920247631 1:204600354-204600376 CAGTCTCAGCTGTGTGACCGTGG + Intergenic
920678804 1:208057467-208057489 AAGGCTGAGCTGGGTTCCTCAGG + Intronic
921841980 1:219838432-219838454 ATGTATGAGCTGAGTGACTCTGG - Intronic
922873494 1:228921531-228921553 CAGTCTTTGCTGCATGACTCCGG - Intergenic
924461810 1:244266306-244266328 CTGGCTGAGCTGGGTCCCTCTGG - Intergenic
1063886979 10:10589548-10589570 CAGTCTGAGCTAGGTAGCTGTGG + Intergenic
1064486273 10:15794155-15794177 CATTCTGAGGAGGGTGACACAGG + Intronic
1067796893 10:49327285-49327307 GAGTCTGAGCTGGGGGCCTTAGG - Exonic
1073148729 10:101297429-101297451 CAATCTGAGCTGTGTAACTGAGG + Intergenic
1076631966 10:131856821-131856843 GAGTCTGAGATGGGAGCCTCAGG + Intergenic
1078058762 11:8030371-8030393 GAGTCTCAGCTGGGAGATTCTGG + Intronic
1081811613 11:45917448-45917470 CTGTCAGAGCTGGGTGAGCCGGG - Exonic
1081864718 11:46353227-46353249 CAGTGTGAGCTGGGGGATCCTGG - Intronic
1085456690 11:76669602-76669624 CCTTATGAGCTGGGTAACTCTGG - Intronic
1087422282 11:97944973-97944995 CAGTCTGAGGTTGGTGAGCCAGG + Intergenic
1087977314 11:104565352-104565374 CTGTCTGGGCTGGGTGAGGCCGG - Intergenic
1088963645 11:114696053-114696075 CAGGCTGAGCTCAGTGGCTCAGG + Intronic
1089703312 11:120258903-120258925 CAGTCTGAGATGGGGCCCTCTGG - Intronic
1092237125 12:6817279-6817301 CAGTGTCTGCTGAGTGACTCGGG + Exonic
1092467135 12:8743070-8743092 CAGTCTGGGCACGGTGGCTCAGG + Intronic
1093908142 12:24715843-24715865 GCATCTGAGCTGGGGGACTCTGG - Intergenic
1096087794 12:48877757-48877779 GAATCTGATCTGGCTGACTCCGG - Intergenic
1098643933 12:72873922-72873944 CAGTCTGAGCTGACTGCCTGGGG - Intergenic
1099220644 12:79909979-79910001 CAGGCTGGGCGGGGTGGCTCAGG - Intronic
1099948057 12:89267590-89267612 CATTCTTAGCTTTGTGACTCAGG - Intergenic
1102908919 12:116697652-116697674 CATTCGGGGCTGGGTGACTGTGG - Intergenic
1103454490 12:121054113-121054135 CAGCCTAACCTGGGTGCCTCTGG - Intergenic
1104118624 12:125775121-125775143 AAGTCTGAAATGGGTGTCTCTGG - Intergenic
1105330429 13:19410772-19410794 CAGCCTGTGCTGGGTGCCTAAGG - Intergenic
1105918510 13:24939557-24939579 CAGCCTGTGCTGGGTGCCTAAGG - Intergenic
1107481987 13:40792767-40792789 CAGCCTGTGCTGGGTGCCTAAGG - Intronic
1108180507 13:47835672-47835694 CAGTCGCAGCTGGGTGACTCAGG + Intergenic
1108662219 13:52597662-52597684 CAGCCTGTGCTGGGTGCCTAAGG + Intergenic
1109770810 13:66970345-66970367 AAGTCTGGGCATGGTGACTCAGG + Intronic
1111319949 13:86614312-86614334 AAGTCTGAGCAGGGTGACAGTGG + Intergenic
1112431455 13:99354237-99354259 CAGTGTGAGCCGGGTGACATGGG + Intronic
1113412497 13:110102429-110102451 GAGGCTTAGCTGGGTGGCTCTGG - Intergenic
1113786512 13:113004664-113004686 CTCCCTGAGCTGTGTGACTCTGG - Intronic
1113821645 13:113218551-113218573 CAGTCTGAGATGGGGGTCACTGG - Intronic
1118642384 14:67804792-67804814 CATTGTGAGCTGTGTGACTTTGG + Intronic
1119628209 14:76201735-76201757 CACTCAGAGCTGGGTGATTTGGG - Exonic
1119735758 14:76980715-76980737 CAGTATGAGCTGAGTGACTGTGG + Intergenic
1120075435 14:80151709-80151731 CAGTACTAGATGGGTGACTCAGG - Intergenic
1121485743 14:94313089-94313111 AAGTCTTTCCTGGGTGACTCTGG + Intronic
1126667166 15:51085987-51086009 CATTCAGAGCTGGATGACTCAGG - Intronic
1127275982 15:57444577-57444599 CAGCCTGAACTGGGTAAGTCAGG + Intronic
1128034390 15:64511042-64511064 AACTCTGAGCTGGGTGAGTTAGG - Intronic
1128123244 15:65170481-65170503 TAGGCTGAGCGGGGTGGCTCAGG + Intronic
1129296870 15:74604553-74604575 CAGCTTGAGCTGGGTGCCTGTGG - Intronic
1129604800 15:77019621-77019643 CAATCTGAGCTGTGGGACTGTGG + Intronic
1132610860 16:815657-815679 CACTCTGGCCTGGGTGACTAAGG - Intergenic
1132775360 16:1590645-1590667 CTGTGTGAGCTTGGGGACTCAGG + Intronic
1132806004 16:1775417-1775439 CTGTCTGAGCTGGGTGAGTCAGG + Intronic
1133207463 16:4241972-4241994 CAGTCTGGGCTGGGTCATGCTGG + Intronic
1133675036 16:8063288-8063310 CTGTCTGAGCATGGTGACTGCGG + Intergenic
1135918875 16:26630601-26630623 CAGGCTCAGCTGGGGGTCTCGGG + Intergenic
1135961312 16:26996683-26996705 CAGTCTGATGTGAGTGACCCTGG + Intergenic
1136516490 16:30771781-30771803 TGGTCTGAGCCTGGTGACTCAGG - Intronic
1137667554 16:50260594-50260616 CAGGCTGAGCTGGGTGCTTCTGG + Intronic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138649884 16:58453858-58453880 CAGTCTGAAATGGGTCTCTCTGG + Intergenic
1139325550 16:66150148-66150170 CAGTTTAAGATGGGGGACTCAGG - Intergenic
1139659061 16:68408541-68408563 CACTAAGATCTGGGTGACTCTGG + Intronic
1139914929 16:70422045-70422067 CAGGCTGGGCTTGGTGGCTCAGG - Intronic
1141109277 16:81258630-81258652 CACTCTCAGATGGGTGACCCTGG + Intronic
1141882120 16:86867137-86867159 CAGCCTGGGCTGGGTGGCTGTGG - Intergenic
1142060370 16:88025389-88025411 GAATCTTGGCTGGGTGACTCGGG - Intronic
1143916385 17:10296395-10296417 CAGGCTGAGCTGGGTACCTCTGG - Intergenic
1144148841 17:12423840-12423862 CAGTCCGAGCTGGCTGATACAGG - Intergenic
1144665628 17:17100248-17100270 CAGACTGAACTTGGTGATTCAGG - Intronic
1144839716 17:18178506-18178528 CCGTGTGAGCTGTGTGACCCAGG - Intronic
1145840938 17:27993807-27993829 GAGTCTTAGCTGGATGCCTCTGG + Intergenic
1148577286 17:48720805-48720827 TGATCTCAGCTGGGTGACTCCGG + Intergenic
1149343182 17:55707652-55707674 GACTCTGAGCTGAGTGACCCTGG - Intergenic
1150445275 17:65223616-65223638 CAGTGAGAGCTGGCTGACCCCGG - Intronic
1150863782 17:68827890-68827912 CAGGCTGAGCGGGGTTGCTCAGG - Intergenic
1151522080 17:74637401-74637423 CAGTTTGAGCGCGGTGGCTCAGG - Intergenic
1152151151 17:78602198-78602220 CAGACGGAGCTGGATGACTTTGG - Intergenic
1152195908 17:78918283-78918305 CAGTCTGACCTGGCTGACTGGGG + Intronic
1152554391 17:81045785-81045807 CTGTCTGATCTGAGTGGCTCTGG + Intronic
1152727053 17:81952666-81952688 CTGTCTGAGCTGGTGGACTGAGG + Exonic
1153618052 18:6952172-6952194 CACTCTCAGCTGGGAGACTGAGG + Intronic
1156486988 18:37472650-37472672 CACTCTGAGCTGTGTGACCTTGG - Intronic
1156973535 18:43187893-43187915 TATTCTGAACTGAGTGACTCGGG - Intergenic
1157197254 18:45629541-45629563 CCTTCTTAGCTGTGTGACTCAGG + Intronic
1157393937 18:47326256-47326278 CAGTCTTAGGAGGGTGAGTCTGG + Intergenic
1159999348 18:75001988-75002010 CATTCTGGACTGGGTGACTCTGG - Intronic
1160557420 18:79735304-79735326 CAGCCTGCGCTGGGGGACTGTGG + Intronic
1160692897 19:467922-467944 CTGCCTGAACTGGGTGCCTCAGG + Intronic
1161112073 19:2476110-2476132 CGATCTGAGCTGGGAGCCTCCGG - Exonic
1161296840 19:3524404-3524426 CAGGCTGTGCTGGGTGACTGCGG - Intronic
1161315389 19:3615037-3615059 CAGCCTGGGCTGTGTGACTGTGG + Intronic
1161537128 19:4826749-4826771 CCTTATGAGCTGTGTGACTCTGG - Intronic
1162387064 19:10365942-10365964 CAGGCCCAGCTGGGTGACACAGG + Intronic
1162484776 19:10952886-10952908 CAGTCTGAGAAGAGTGAGTCTGG - Intergenic
1162571480 19:11476615-11476637 CAGGCTGGGCTTGGTGGCTCAGG + Intronic
1162795687 19:13086409-13086431 CAGTTGCAGCTGGGTGACTTAGG + Intronic
1162908794 19:13838765-13838787 GCTTCTGAGCTGGGTGACTCTGG + Intergenic
1163247944 19:16108945-16108967 CAGTCTGTTCTAGGTCACTCTGG - Intergenic
1163626319 19:18391929-18391951 CAGTCCCTGCTGGGTGACTCAGG - Exonic
1163777704 19:19227712-19227734 AAGTCTGCCCTGGGGGACTCAGG - Exonic
1164907132 19:31976678-31976700 GAGTCTGAGCTGGGTCACGCTGG - Intergenic
1165061794 19:33208396-33208418 CAGTCTGAGCTCGGCCACCCAGG - Exonic
1165205128 19:34177603-34177625 CCGGCTGGGCAGGGTGACTCAGG + Intronic
1165749747 19:38252647-38252669 CCTTCTGAGCTGTGTGACACTGG + Intronic
926311213 2:11677542-11677564 GAGGCTGGGCTGGGTGACACTGG - Intergenic
926324238 2:11770534-11770556 CAGCCTCAGCTGTGTGTCTCAGG + Intronic
926886044 2:17599809-17599831 AAGGCTGGGCTGAGTGACTCAGG - Intronic
926910359 2:17847229-17847251 CTGTCTGGGCTCGGTGGCTCAGG - Intergenic
927469398 2:23361487-23361509 TAGTCTGAGTTGGGTGTCCCTGG - Intergenic
929092713 2:38235480-38235502 CCGTATAAGCTGGGTGACTTTGG - Intergenic
930167391 2:48216726-48216748 CAGTCTGGGCACGGTGGCTCAGG + Intergenic
932754407 2:74396447-74396469 CAGGCTGAGCCTGGTGGCTCAGG - Intergenic
932919002 2:75888513-75888535 CAGTCTGTGCTGGCTGATTCAGG + Intergenic
933921212 2:87048709-87048731 CATGCTGTGCTGGGTGACTTTGG - Intergenic
934001754 2:87720876-87720898 CATGCTGTGCTGGGTGACTTTGG + Intergenic
935184739 2:100721941-100721963 CAGTCTGAGCTGTTTGCCTTAGG + Intergenic
936362708 2:111820360-111820382 CATGCTGTGCTGGGTGACTTTGG - Intronic
936833845 2:116682914-116682936 CAGTTTGTGCTGGATGAGTCAGG - Intergenic
937030092 2:118731777-118731799 CAATCTGAGCTGGGGAACCCTGG - Intergenic
940617768 2:156072056-156072078 CAGTCAGAGCTGTGTGTCTTAGG - Intergenic
942562516 2:177235546-177235568 GAGGCTGAGCTTGGTGACTCAGG + Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
947937150 2:234017072-234017094 CGGTGTGAGCTGCGTGACTAAGG - Intronic
948616461 2:239202447-239202469 CAGACCCAGCGGGGTGACTCTGG + Intronic
948733556 2:239983090-239983112 CATTCTGACCTGAGTGACTTCGG - Intronic
948832694 2:240605955-240605977 CAGGCTGACCTGGGAGTCTCCGG + Intronic
1169158268 20:3353253-3353275 CACTCTGAGATGGGTGGCTTTGG - Intronic
1170958260 20:21001533-21001555 GTGGCTGAGCTGGGTGGCTCTGG - Intergenic
1172640765 20:36439265-36439287 CTTTCTCAGCTGGGTGACCCTGG - Intronic
1172876674 20:38168522-38168544 CACTCTTGGCTGTGTGACTCTGG + Intergenic
1172967653 20:38849468-38849490 AAGTCTGATCTGGCTCACTCTGG + Intronic
1174165000 20:48578199-48578221 CAGTTTGAGCTCCGTGACCCTGG + Intergenic
1174367569 20:50065664-50065686 CAGGCAGTGCTGGGTGACCCTGG - Intergenic
1174419126 20:50388142-50388164 CAGACTGGGCTGGGAAACTCTGG - Intergenic
1175240616 20:57545586-57545608 CAGTCTGAGATGGGTGCTCCTGG + Intergenic
1175417364 20:58810786-58810808 CAGCCTGAGGTGGTTGAGTCAGG + Intergenic
1175904363 20:62372282-62372304 CATGCTGGGCAGGGTGACTCGGG + Intergenic
1176104366 20:63378902-63378924 CAGTCTGAGGTGGAAGACACAGG + Intergenic
1176172625 20:63702905-63702927 AGGTCTGAGCTCAGTGACTCTGG - Intronic
1176263567 20:64196524-64196546 CCGTAAGAGCTGGGTGACTTGGG - Intronic
1178052305 21:28761528-28761550 CAGTCTGAGTTATGTGACACAGG - Intergenic
1178977642 21:37233153-37233175 CGGCCTCAGCTGGGGGACTCTGG + Intronic
1179553242 21:42156595-42156617 CAGCCAGAGCTGGGGGTCTCAGG - Intergenic
1180092037 21:45538196-45538218 CAGCCTGGCCTGGGGGACTCCGG - Intronic
1182268645 22:29138754-29138776 CAGTCTGAGGTGGGTGGCTGGGG - Exonic
1182763556 22:32742326-32742348 CATTCTGGGCTGTGTGACTAAGG - Intronic
1184038324 22:41928953-41928975 CAGTCAGGGCTGGCTGACTGGGG - Intergenic
1184110023 22:42389071-42389093 CTCTCTGAGCTGGATGATTCTGG + Intronic
1184709452 22:46240018-46240040 CAGTCTTAGCTGGGTGCATTGGG - Exonic
1184907415 22:47498119-47498141 CAGTAGGAGCTGGGTCACCCTGG + Intergenic
1185040335 22:48500796-48500818 CAGACAGGGCTGGGGGACTCAGG + Intronic
949813891 3:8038303-8038325 CAGCCTGAGCTGGGTAAATAAGG + Intergenic
953574892 3:44105098-44105120 CAGCCTGAGCTGGGAGACACTGG - Intergenic
954691069 3:52395893-52395915 CGGTCTGTGCTGGGTGTCCCTGG - Intronic
955234866 3:57130606-57130628 CCGTCAGAGCTTGGTGACTGTGG - Intronic
955339277 3:58112373-58112395 CAGTCGGTGCTGGGTCACTGTGG + Intronic
955353265 3:58209663-58209685 CAGGCTCTGCTGGGTGCCTCAGG + Intronic
961958938 3:130833664-130833686 CAGTCTGAGGGGGGTGATTTGGG - Intergenic
963831344 3:150012824-150012846 CAGTCTGAGTGGTGAGACTCAGG - Intronic
964663602 3:159148947-159148969 CAGTATGATCTGGGTCACTATGG + Intronic
965863563 3:173176757-173176779 ATGTCTTAGCTGGGTGCCTCTGG - Intergenic
965868618 3:173238152-173238174 CAGTATGGGCTGAGTGATTCTGG - Intergenic
968123002 3:196139556-196139578 CAGTCTGAGGTGGGAGGCTGGGG - Intergenic
969652406 4:8475463-8475485 CAGTCTGTCCTGGGACACTCGGG + Intronic
969871617 4:10108233-10108255 CAGTCTCAGGTGGGTGACGGAGG + Intronic
972295322 4:37732312-37732334 CAGGCTGGGCATGGTGACTCAGG + Intergenic
973039985 4:45457533-45457555 CTGTCTGGGCTGGCTGACGCTGG - Intergenic
976821862 4:89215893-89215915 CAATCTGTGCTGGCTGGCTCTGG - Intergenic
981114137 4:140970043-140970065 AAGTCTGGGCATGGTGACTCAGG - Intronic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
985632300 5:1020431-1020453 GAGGCTGAGCAGGGTGACTAGGG - Intronic
985909691 5:2869214-2869236 CAGTCTGGCCTGAGTGATTCTGG + Intergenic
986314620 5:6578258-6578280 CAGTCCCAGCTTTGTGACTCAGG + Intergenic
986706343 5:10457491-10457513 CAGTCCTGGCTGGGTGACTTGGG + Intronic
992233068 5:74682459-74682481 GAGTCTTAGCTGGGTGATTCTGG - Intronic
997091051 5:130858808-130858830 GATTCTTAGCTGGGTGACTTTGG + Intergenic
997198290 5:131994170-131994192 CTGCCTGAGCTAGGTGACTTGGG - Exonic
997444088 5:133928722-133928744 CACTCTGAACCGGGTCACTCAGG + Intergenic
998351050 5:141501595-141501617 CAGTTCCAGCTGTGTGACTCTGG + Intronic
1001800900 5:174543150-174543172 CACTCCCAGCTGGGTGACTTTGG + Intergenic
1001937205 5:175713974-175713996 CTCTAAGAGCTGGGTGACTCGGG - Intergenic
1002177324 5:177408614-177408636 ACTTATGAGCTGGGTGACTCTGG - Intronic
1003103254 6:3193660-3193682 CAGACAGTGCTGGGTGACTGTGG - Intergenic
1003127552 6:3367650-3367672 CACTATGAGCTGTGTGACTTTGG - Intronic
1005348279 6:24910930-24910952 CAGCCTGAGCTGGCTCACTTGGG + Intronic
1005670838 6:28104884-28104906 CTGGCTGAGCTGGGGGACTCGGG - Intergenic
1006425717 6:33961765-33961787 AAGTCTGAGCTGCCTGCCTCGGG + Intergenic
1006831724 6:36972134-36972156 CAGTTCCAGCTGAGTGACTCTGG + Intronic
1007602753 6:43093376-43093398 AAGGCTGAGCTGGGGGACACTGG + Intronic
1010479373 6:76331859-76331881 AAGTCTGAGTTGGATGACTGGGG + Intergenic
1013244724 6:108275539-108275561 CAGTCTGAGTTTGATGTCTCTGG + Intergenic
1013638830 6:112053774-112053796 GAATCTGAGCTGGGGGAGTCAGG + Intergenic
1017880266 6:158558047-158558069 CATGCTGACCTGGGTGACGCTGG + Intronic
1018068730 6:160142370-160142392 CAGTCTGAACTGGGTCCCTCTGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018352071 6:162970307-162970329 CAGTCTGAGGAGGGTGTCTGGGG + Intronic
1018364673 6:163107490-163107512 CAGTGTGCGCCGTGTGACTCAGG - Intronic
1018838248 6:167501090-167501112 CAGTCTCAGCTGTGAGACTGAGG - Intergenic
1019282639 7:208054-208076 CAACCTGAGCAGGGTGACTTTGG - Intronic
1019318354 7:401921-401943 CACACTGTGCTGGGTGGCTCAGG + Intergenic
1020999438 7:15310321-15310343 CATTCTTAGCTGCATGACTCTGG + Intronic
1022241866 7:28520195-28520217 CAGTATGAACTAGCTGACTCAGG + Intronic
1022810109 7:33860255-33860277 GGGTGTGAGCTGGGAGACTCAGG - Intergenic
1023605308 7:41925921-41925943 CAGTCTAAGCTGTGTGACCTTGG + Intergenic
1025251832 7:57356544-57356566 CAGGCTGGGCTGGGAAACTCTGG + Intergenic
1025852685 7:65257494-65257516 CAGGCTGAGGTGGGAGAATCAGG - Intergenic
1026281437 7:68925502-68925524 ATGTCTCAGCTGGGTGACTTAGG + Intergenic
1027262885 7:76477595-76477617 TAGTCTCAGCTGGGTGACAGAGG + Intronic
1027314267 7:76975704-76975726 TAGTCTCAGCTGGGTGACAGAGG + Intergenic
1028280978 7:88927445-88927467 CAGACTGAGCATGGTGTCTCAGG - Intronic
1031798590 7:126212229-126212251 CATTCTGAACTGGGTGACTTTGG - Intergenic
1031919156 7:127588665-127588687 CGTTATGAGGTGGGTGACTCGGG - Intronic
1033399004 7:141004061-141004083 GAGTCTGAGGTGGGTGGATCAGG + Intergenic
1034300179 7:150008670-150008692 CAGTGTGAGATGGGTCACTGGGG - Intergenic
1034805871 7:154088638-154088660 CAGTGTGAGATGGGTCACTGGGG + Intronic
1035393284 7:158519604-158519626 CATGTTGATCTGGGTGACTCTGG + Intronic
1035396613 7:158539084-158539106 CAGGCTGTGCTGGCTGACACGGG - Intronic
1035978152 8:4336176-4336198 CGGTCAGCGCTGGTTGACTCAGG + Intronic
1036658330 8:10691870-10691892 CGGACTGAGCTGGGGGACCCAGG - Intronic
1038306367 8:26406778-26406800 CACTCTGGCCTGGGTGACACAGG + Intronic
1039349886 8:36752243-36752265 TAGTCTCAGCTGGGAGACTGAGG - Intergenic
1042330668 8:67577134-67577156 CAGGCTGGGCTAGGTGACTCAGG - Intronic
1045194978 8:99921491-99921513 CTGTCTTAGCTAGATGACTCTGG + Intergenic
1047646103 8:126871783-126871805 CACTCTGAGCTGTGTGCGTCAGG + Intergenic
1048470377 8:134699388-134699410 CACACTGACCTGGGTGAGTCTGG + Intronic
1048774289 8:137928718-137928740 CAGTTATAGCTGTGTGACTCTGG - Intergenic
1051334709 9:16055363-16055385 CTGGCTGAGCTGGGTCACTGAGG + Intronic
1051534828 9:18144758-18144780 CCCTCTGAGCTGGGTGACTTTGG - Intergenic
1051572561 9:18576924-18576946 CAGACAGAGCTGGGAGTCTCTGG - Intronic
1052562077 9:30097478-30097500 CACTGAGAGCTGTGTGACTCTGG + Intergenic
1055689280 9:78811771-78811793 CAAGCTGAGATGTGTGACTCAGG + Intergenic
1056747777 9:89318890-89318912 CAGTCGGGGCGGGGGGACTCTGG + Intronic
1056799971 9:89684167-89684189 AAGGCTCAGCTGGGTGGCTCTGG - Intergenic
1058898085 9:109417272-109417294 CAGCCTGAGCTGCGCCACTCTGG + Intronic
1060426949 9:123514147-123514169 CAGCCTAAGGTGGGTGACTAAGG + Intronic
1060875409 9:127079778-127079800 ATGTCTTAGCTGGGTGTCTCTGG - Intronic
1060925290 9:127451610-127451632 AAGTCTGAGAAGGGTGGCTCCGG + Exonic
1061130164 9:128703889-128703911 CAGCGGCAGCTGGGTGACTCAGG + Intronic
1061204355 9:129154499-129154521 CAGTCGGGGCTGGGGGATTCAGG + Intergenic
1061636650 9:131914810-131914832 CAGCCTGAACTGGGTGGCACTGG + Intronic
1062142455 9:134967127-134967149 CAGTCTGGGCTGGGAGGCACTGG - Intergenic
1062160439 9:135076681-135076703 CGCTCTGAACTGGGAGACTCTGG + Intronic
1062579381 9:137222633-137222655 CAGGCGGAGCTGGAGGACTCGGG - Intergenic
1188953173 X:36401883-36401905 TAGTCTTAGCTGGGAGACTGAGG - Intergenic
1189951155 X:46232621-46232643 AAGTCTGAGCATGGTGGCTCAGG + Intergenic
1192796613 X:74428782-74428804 CCTTCTGAGCTGGGTTACTAGGG - Intronic
1195991820 X:110690774-110690796 CAGTATGAGGTGGGAGACTGAGG - Intronic
1196594142 X:117523382-117523404 CAGTTTGAGCTGGGTGGTTTTGG - Intergenic
1198182257 X:134221316-134221338 CAGTCTGGGCGAGGTGGCTCAGG + Intergenic
1198244754 X:134819601-134819623 CAGCCTGGGCGAGGTGACTCAGG + Intronic
1199913021 X:152308072-152308094 CAGTCTGATCTGAGTGCCCCTGG + Intronic
1199925626 X:152460607-152460629 CAGGCTGGGCACGGTGACTCAGG + Intergenic
1200988049 Y:9324952-9324974 CAGCCGGGGCTGGGTGCCTCAGG - Intergenic
1202160239 Y:21926361-21926383 CAGTCTGAGGAGGGTGGATCAGG + Intergenic
1202231117 Y:22660021-22660043 CAGTCTGAGGAGGGTGGATCAGG - Intergenic
1202312041 Y:23536144-23536166 CAGTCTGAGGAGGGTGGATCAGG + Intergenic
1202558762 Y:26134450-26134472 CAGTCTGAGGAGGGTGGATCAGG - Intergenic
1202600889 Y:26592035-26592057 CAGCCTGTGCTGGGTGCCTAAGG + Intergenic