ID: 903474310

View in Genome Browser
Species Human (GRCh38)
Location 1:23608914-23608936
Sequence TGAACTCTGCGTACTACACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 25}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903474310 Original CRISPR TGAACTCTGCGTACTACACG AGG Intronic
903474310 1:23608914-23608936 TGAACTCTGCGTACTACACGAGG + Intronic
906638730 1:47428075-47428097 TGAACTCTTCTTGCTACACCTGG + Intergenic
912143343 1:106758936-106758958 TGAAGTCTGAGAACTACACAGGG - Intergenic
922152280 1:223016782-223016804 AAAGCTCTGCTTACTACACGAGG - Intergenic
923923668 1:238598844-238598866 TGAACTCTGCTTCCTGCACAGGG - Intergenic
1064503445 10:16001036-16001058 TGATCTCTGCCTTCTACAAGAGG - Intergenic
1094493616 12:30976293-30976315 TAAACTTTGCGTCCTACACGAGG + Intronic
1120282086 14:82452388-82452410 TGAACTCTCCGAACTTCACTGGG + Intergenic
1121906412 14:97750313-97750335 TGAACACAGCCTACTACACGAGG - Exonic
1148562588 17:48614374-48614396 TGCAGTCTGCGTACTGCACCAGG + Exonic
1163359079 19:16834311-16834333 TGAACTGTGCGTCCTGCATGTGG + Intronic
926798397 2:16637901-16637923 TGAACTCTGTGTCCTTCACCAGG + Intronic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
927656347 2:24950118-24950140 TAAACTCTGTGCCCTACACGAGG + Intronic
932773275 2:74513422-74513444 TGAACTCTGCGTCCTTCCCGGGG - Intergenic
933287261 2:80397893-80397915 TGCACTCTGGGAAATACACGTGG + Intronic
943487365 2:188502917-188502939 TGAACTCTGTGTGCTCCAGGAGG + Intronic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
948647793 2:239418956-239418978 TGAACTCTCCTAACTACACAGGG + Intergenic
1170487303 20:16831547-16831569 TCACCTCTGCGTAGTACACATGG + Intergenic
1180004665 21:45014750-45014772 TGAACTCTGAGTGCAACAAGAGG + Intergenic
1181880762 22:25978054-25978076 TAAGTTCTGAGTACTACACGAGG + Intronic
968207782 3:196819708-196819730 TGAACATTGAGTACTACACTAGG + Intronic
982325988 4:154128620-154128642 TGAAGTCTGAGGACTACACTTGG - Intergenic
990805812 5:59660309-59660331 TGAGCTCTGCTTACTAAACATGG - Intronic
999664661 5:153899873-153899895 AGAATTCTGCCTACTACACTGGG + Intergenic
1005424664 6:25689794-25689816 TGAACTCTTAGTCCTACAAGAGG - Intronic
1019114975 6:169752429-169752451 GGAACTCTGCAGACTACACTGGG - Intronic
1042254330 8:66787933-66787955 AGAACTCTGAGCAGTACACGTGG - Intronic
1048541037 8:135342318-135342340 TGAACTCTGCCTACTGCAAAAGG + Intergenic