ID: 903475849

View in Genome Browser
Species Human (GRCh38)
Location 1:23618704-23618726
Sequence CACACTGCAGTGAGCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903475836_903475849 28 Left 903475836 1:23618653-23618675 CCAAGGGCAGGACCCAGCCTGAC 0: 1
1: 0
2: 6
3: 42
4: 302
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475842_903475849 6 Left 903475842 1:23618675-23618697 CCTTCCTCTCCACCCTTGGGCCA 0: 1
1: 1
2: 1
3: 31
4: 408
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475835_903475849 29 Left 903475835 1:23618652-23618674 CCCAAGGGCAGGACCCAGCCTGA 0: 1
1: 0
2: 2
3: 23
4: 226
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475846_903475849 -7 Left 903475846 1:23618688-23618710 CCTTGGGCCATCGCTGCACACTG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475843_903475849 2 Left 903475843 1:23618679-23618701 CCTCTCCACCCTTGGGCCATCGC 0: 1
1: 0
2: 0
3: 10
4: 134
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475845_903475849 -6 Left 903475845 1:23618687-23618709 CCCTTGGGCCATCGCTGCACACT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475837_903475849 16 Left 903475837 1:23618665-23618687 CCCAGCCTGACCTTCCTCTCCAC 0: 1
1: 0
2: 4
3: 67
4: 500
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475838_903475849 15 Left 903475838 1:23618666-23618688 CCAGCCTGACCTTCCTCTCCACC 0: 1
1: 0
2: 12
3: 96
4: 738
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475844_903475849 -3 Left 903475844 1:23618684-23618706 CCACCCTTGGGCCATCGCTGCAC 0: 1
1: 0
2: 0
3: 15
4: 96
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475839_903475849 11 Left 903475839 1:23618670-23618692 CCTGACCTTCCTCTCCACCCTTG 0: 1
1: 0
2: 3
3: 39
4: 519
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160
903475834_903475849 30 Left 903475834 1:23618651-23618673 CCCCAAGGGCAGGACCCAGCCTG 0: 1
1: 0
2: 3
3: 54
4: 370
Right 903475849 1:23618704-23618726 CACACTGCAGTGAGCTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903475849 Original CRISPR CACACTGCAGTGAGCTCCAT GGG Intronic