ID: 903486314

View in Genome Browser
Species Human (GRCh38)
Location 1:23691763-23691785
Sequence GGGCCTTATGGGCCAGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903486314_903486325 19 Left 903486314 1:23691763-23691785 CCGCCTCCTGGCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 24
4: 320
Right 903486325 1:23691805-23691827 TCTCTTCCTGCTCTCCATCATGG 0: 1
1: 0
2: 4
3: 36
4: 370
903486314_903486326 22 Left 903486314 1:23691763-23691785 CCGCCTCCTGGCCCATAAGGCCC 0: 1
1: 0
2: 0
3: 24
4: 320
Right 903486326 1:23691808-23691830 CTTCCTGCTCTCCATCATGGCGG 0: 1
1: 0
2: 1
3: 28
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903486314 Original CRISPR GGGCCTTATGGGCCAGGAGG CGG (reversed) Exonic
900098654 1:951564-951586 TGGCCTCTTTGGCCAGGAGGGGG - Intronic
900251386 1:1671981-1672003 AGGCCCTGTGGGCCGGGAGGGGG + Intronic
901051738 1:6428907-6428929 GGGGCTCTGGGGCCAGGAGGTGG - Intronic
901527911 1:9835681-9835703 GGGCCTGAAGGGGCAGCAGGAGG + Intergenic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
904438273 1:30513464-30513486 TGGCCTGAGGGGCTAGGAGGTGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905387521 1:37614658-37614680 GGGCCGTCTGGGCCTGGTGGGGG + Intronic
906193587 1:43914785-43914807 GGGCCTGCTGGGCCTGGAGAAGG + Intronic
906322940 1:44827950-44827972 GGACCTTCTAGGCCAGGAGGAGG - Exonic
908510162 1:64844826-64844848 TGCCCTCACGGGCCAGGAGGAGG + Exonic
909350705 1:74649911-74649933 GGGTCTTATGGGGTAGGAGGTGG - Intronic
911091647 1:94022142-94022164 GGGCCTCAGAGGCCAGGATGAGG - Intronic
912437909 1:109674836-109674858 GGGCCTTGAAGGCCAGGAGGTGG + Exonic
912440420 1:109693295-109693317 GGGCCTTGAAGGCCAGGAGGTGG + Exonic
915938522 1:160103275-160103297 GAGCCTCAGGGGGCAGGAGGTGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920915295 1:210253562-210253584 GGGCCTGATGGGGCTGGTGGTGG + Intergenic
921390193 1:214607883-214607905 GGGCCTCATGGGCCAGGCCTCGG + Intronic
922616075 1:226961898-226961920 TGTCCTCATGGGGCAGGAGGAGG + Intronic
1063649291 10:7917509-7917531 GGGCCTTATAGGCCATGATATGG + Intronic
1067055032 10:43045268-43045290 GGAGCTTATGGACAAGGAGGAGG - Intergenic
1067070884 10:43131032-43131054 GGGCCTCATGGGCCTGGGGCGGG - Intergenic
1067077647 10:43197314-43197336 CGGCCTGATGGCCCAGGTGGAGG - Intronic
1067682112 10:48447941-48447963 TGGCCCTATGGGGCAGCAGGTGG - Intronic
1068782018 10:60929945-60929967 GGGCCTTATGGCCCAGTATGTGG - Intronic
1070722288 10:78765090-78765112 AGGCCTTAGGGGACAGAAGGGGG - Intergenic
1071186960 10:83057631-83057653 GGGACTTATTGTCCAGGAGAAGG - Intergenic
1072460751 10:95616512-95616534 GAGCCTCCTGGGTCAGGAGGTGG + Exonic
1072685628 10:97534948-97534970 AGCCCTCATTGGCCAGGAGGGGG + Intronic
1072757340 10:98030102-98030124 GGGCCTCTGGGGCCTGGAGGGGG - Intronic
1073292959 10:102422299-102422321 GGGCCTGATAGGGCGGGAGGAGG + Intronic
1073436825 10:103522052-103522074 GGAGCTTCTGAGCCAGGAGGAGG + Intronic
1074377547 10:112951741-112951763 GGGCCTCCTGGGCCACGAGCGGG - Intronic
1074516428 10:114174354-114174376 GGGCCTCCTGGGCCGGGAGGTGG - Intergenic
1074861742 10:117515206-117515228 GGGCCATGTGGGCTGGGAGGTGG - Intergenic
1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG + Intronic
1076536588 10:131181687-131181709 GGGCCAGGTGGGCCAGGAGCAGG + Intronic
1076847472 10:133076332-133076354 GGGCCACAGGGTCCAGGAGGAGG + Intronic
1076981815 11:208772-208794 GGGCTTTCTGGGCCAGGGCGGGG + Exonic
1077062434 11:623800-623822 GGCCCTGATGGGACTGGAGGTGG + Intronic
1077141351 11:1026266-1026288 GGGCCATCTGGGGCAGGCGGAGG - Intronic
1077167650 11:1151022-1151044 GGGCCCTCTGGGCAGGGAGGGGG - Intergenic
1077230673 11:1456992-1457014 TGGGCTTAAGGGCCAGAAGGTGG + Intronic
1078070980 11:8110190-8110212 GGGGCTAATGGGCCCAGAGGAGG - Exonic
1078377427 11:10808136-10808158 GGGATTTATGGTGCAGGAGGGGG - Intronic
1079125587 11:17716537-17716559 GGGCCTGATAGGCCAGGGGATGG + Intergenic
1080628668 11:34052757-34052779 GGGGCGTGTGGGCCAGGGGGTGG - Intronic
1080663125 11:34313475-34313497 GGGCCCCAAGGGGCAGGAGGTGG - Intronic
1083741154 11:64712438-64712460 GGGGCTTATGAGACAGGGGGCGG - Intronic
1083752163 11:64766745-64766767 GGGCCTCCTGGTCCAGGGGGTGG - Intronic
1083752405 11:64767735-64767757 GGTCCTGGTGGGCCCGGAGGTGG - Exonic
1083965814 11:66043106-66043128 GGGCCTCATCCGCCAGGTGGAGG - Exonic
1085987656 11:81806327-81806349 GGAGCTTATGAGCCAGGAGAAGG - Intergenic
1086108177 11:83169363-83169385 GGTCCTTCTGTACCAGGAGGTGG + Exonic
1086657765 11:89381424-89381446 GGAGCTTTTGGGCCAGGAGAAGG - Intronic
1087642449 11:100769812-100769834 GGGCCTGTTTGGCCAGGGGGAGG + Intronic
1088005347 11:104933048-104933070 GGGCCTTTTGGGGCATGAAGGGG + Intergenic
1088565324 11:111166380-111166402 TGGTCTCATGGGCCAGAAGGTGG - Intergenic
1088850483 11:113699804-113699826 TGGGCTGATGGGGCAGGAGGAGG - Intronic
1089578003 11:119460299-119460321 GGGCCTTGCAGGCCAGGAGGTGG + Intergenic
1089912229 11:122112536-122112558 GGGTCTAATGGGACAGGAAGGGG + Intergenic
1090208414 11:124898322-124898344 GTGCCAGATGGACCAGGAGGTGG + Intronic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1091753492 12:3037180-3037202 GGGCCTTGTGAGCCAGGCCGGGG + Intronic
1091808908 12:3378778-3378800 GGGTCCTGTGGGCCAGGAGAGGG - Intergenic
1092448431 12:8579948-8579970 TGTCTTTATGGGCCAGGATGTGG + Intergenic
1093426818 12:19037075-19037097 GGGCTTTATGTATCAGGAGGAGG + Intergenic
1094099325 12:26744189-26744211 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1094351416 12:29530173-29530195 GGGTCTCCTTGGCCAGGAGGGGG - Intronic
1095741075 12:45607878-45607900 ACACCTTATGGGCCAGGAAGGGG + Intergenic
1095800566 12:46267590-46267612 GAGCCCCATGCGCCAGGAGGTGG + Exonic
1098217301 12:68234100-68234122 GGGCTATTTGGGCCATGAGGAGG + Intergenic
1100432802 12:94545826-94545848 GGGCCTTATAGGCCACAAGAAGG + Intergenic
1100871880 12:98918172-98918194 GGGCCTGAGGGGCCATGGGGAGG - Intronic
1101403799 12:104411078-104411100 GGGCCTTATAGGCCATGAAAAGG - Intergenic
1102480783 12:113221734-113221756 GGGCCGTACGGGCCCAGAGGGGG + Intronic
1102687183 12:114734280-114734302 GGGCCTGGTGCTCCAGGAGGAGG - Intergenic
1102812072 12:115832930-115832952 GGGCCTTCTTGGACAGGATGGGG - Intergenic
1103795412 12:123499747-123499769 GGGACTGATGGGCAAGGAAGAGG - Intronic
1104205634 12:126635525-126635547 CAGCCTTATGGGTGAGGAGGTGG + Intergenic
1104727774 12:131088360-131088382 GGCCCTTACGGGGCAGGACGTGG - Intronic
1104935933 12:132364478-132364500 TGGGCTTCTGGGCCAGCAGGAGG - Intergenic
1105265160 13:18808884-18808906 GGGACTTGTGCCCCAGGAGGGGG + Intergenic
1106315625 13:28590854-28590876 GGGCCTGATGGGCCAGCTCGAGG - Intergenic
1107380811 13:39855090-39855112 GGGTCTTCTTGGCCAAGAGGGGG - Intergenic
1113369088 13:109706193-109706215 GGGGCCTGTGGGCCAGGAGTGGG + Intergenic
1114416534 14:22548550-22548572 GGGCCTTCTAGGCCATGAGAGGG + Intergenic
1114690579 14:24576263-24576285 GGGCCTTAAAGTCTAGGAGGAGG - Intergenic
1117406803 14:55411871-55411893 GTGCATTCTGGGCCAGGAGGAGG + Intergenic
1117551081 14:56836862-56836884 GGGCATTATGGGCCAGGCCTGGG + Intergenic
1117842439 14:59873788-59873810 GGGCCTGAGGGGCATGGAGGTGG - Intergenic
1118147594 14:63157350-63157372 GGGACTTGTGGGCCAGCTGGAGG + Intergenic
1119602464 14:75985857-75985879 GGGCCTTGGGGGCCAGGATTTGG + Intronic
1121876672 14:97459103-97459125 GGGCCTCATGGAGCAGGAAGTGG + Intergenic
1122103200 14:99430048-99430070 GGGCCTGATGGGCCCAGAGAGGG + Intronic
1122767515 14:104082245-104082267 TGGCCTCAGAGGCCAGGAGGAGG - Intergenic
1122769198 14:104090356-104090378 GTGCCTTATGGGAAAGGTGGAGG - Intronic
1122925677 14:104898355-104898377 GGGCCACTTGGGCCAGGAGCTGG - Intergenic
1123774765 15:23567067-23567089 GAGCCTCCTGGGCCAGGTGGTGG + Exonic
1123882018 15:24685570-24685592 GGAGCTTATGAGCCAGGAGAAGG + Intergenic
1124291627 15:28457176-28457198 GGGCCTCATGGGCCAGGCCTCGG + Intergenic
1124615097 15:31235879-31235901 GGAGCTTATGGCCCAGGAGCGGG + Intergenic
1125725442 15:41866106-41866128 GGCCCTCAGGGGCCAGGAGCTGG - Exonic
1126247085 15:46519621-46519643 GAACCTTATGGGCCAGAAGGGGG + Intergenic
1126422390 15:48488335-48488357 GAGCCTTAAGGGCCAGGAGAGGG - Intronic
1126465862 15:48961439-48961461 GGGCCTTATGGAGGAGGAAGGGG - Intronic
1127964803 15:63915606-63915628 GGCACTGCTGGGCCAGGAGGAGG - Intronic
1127975372 15:63993137-63993159 GGGGGTTGTGGGCCAGGAAGAGG - Intronic
1129152390 15:73697132-73697154 GGCCCTTGTGGGGCAGGATGTGG + Intronic
1129248606 15:74295642-74295664 GGGCCTCCTGAGCCATGAGGAGG + Intronic
1129316814 15:74750146-74750168 GGGCATTCTGGGCCAGGCGCCGG - Exonic
1129707396 15:77802588-77802610 GGGCCTTCTGGAACTGGAGGGGG - Intronic
1131050340 15:89343450-89343472 GGGTCTGATGGGCCATGAAGAGG + Intergenic
1131527802 15:93166531-93166553 GGGCTTCATGGGCCAGCTGGTGG - Intergenic
1132876980 16:2144331-2144353 GGCCCTTGTGTGCCAGGAGAGGG - Intronic
1132969161 16:2676884-2676906 GGGCCTTGTGGGCCAGAAGAAGG - Intergenic
1132994335 16:2815208-2815230 GGCCCTTATGTGTCAGGAGTCGG + Intergenic
1133168731 16:3966890-3966912 CAGCCTCATCGGCCAGGAGGTGG - Exonic
1133411524 16:5573027-5573049 GGGCCATATGGGGCAGGGGCAGG + Intergenic
1134091150 16:11392316-11392338 GGGCCTGCTGGGCCATGTGGAGG - Exonic
1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG + Exonic
1136035699 16:27538286-27538308 GGCCTTGATAGGCCAGGAGGGGG - Exonic
1136394736 16:29986849-29986871 GAGCATTGTTGGCCAGGAGGAGG + Exonic
1136579225 16:31141924-31141946 GAGCCTTTTGTGCCAGGAGGAGG - Exonic
1136707154 16:32200494-32200516 GGGCCTCATGGGCCAGGCCTTGG - Intergenic
1136737064 16:32475079-32475101 GGGCCTTGTGGGCTAGGTGCCGG + Intergenic
1136760756 16:32728923-32728945 GGGCCTCATGGGCCAGGCCTTGG + Intergenic
1136807347 16:33141463-33141485 GGGCCTCATGGGCCAGGCCTTGG - Intergenic
1137606895 16:49793105-49793127 GGGCCTTATGGGGGTGGTGGGGG - Intronic
1139518100 16:67463803-67463825 GGGCCTTGTGGGACAGGTGCGGG + Intronic
1141266520 16:82502727-82502749 GGGCCTGGTGGGCCAAGAGCAGG + Intergenic
1142123977 16:88401057-88401079 GGGCCTTATGAGCCAGGGTCAGG - Intergenic
1142431101 16:90027844-90027866 GGGAATTATGGGCCACGCGGGGG - Intronic
1203016007 16_KI270728v1_random:354498-354520 GGGCCTTGTGGGCTAGGTGCCGG - Intergenic
1203034342 16_KI270728v1_random:627656-627678 GGGCCTTGTGGGCTAGGTGCCGG - Intergenic
1203062908 16_KI270728v1_random:989237-989259 GGGCCTCATGGGCCAGGCCTTGG + Intergenic
1142608573 17:1095818-1095840 AGGCCTTCTGGGGCAGGAGGTGG - Intronic
1142985183 17:3691055-3691077 GGTCCCTAAGGGGCAGGAGGAGG - Intronic
1143295142 17:5865534-5865556 GGTCTTCATGGACCAGGAGGGGG - Intronic
1147245811 17:39119898-39119920 GGGTCTCATTGGCCAAGAGGGGG - Intronic
1147952089 17:44112958-44112980 GGGCCTGGTTGGCCAGGATGAGG - Intronic
1149567362 17:57649733-57649755 TGGCCTAATGGAACAGGAGGGGG + Intronic
1151157637 17:72137516-72137538 CGGCCTTTTGGGGGAGGAGGCGG + Intergenic
1152212413 17:79009544-79009566 GGGCCTGACGGGTCAGGGGGCGG + Intronic
1155869255 18:31005486-31005508 GGGCCTTGTGTGCCAGGCTGAGG - Intronic
1156289439 18:35733155-35733177 GGGCCTTATAGGCCATGGCGAGG - Intergenic
1156475569 18:37403443-37403465 GGGCCTTGTGTGACTGGAGGAGG - Intronic
1157213494 18:45763367-45763389 GGGCCTGATGGGTCAGGTTGTGG - Intergenic
1157410683 18:47460482-47460504 GGGTCTTGAGGACCAGGAGGGGG - Intergenic
1160427492 18:78788133-78788155 GGGCCTGCAGAGCCAGGAGGTGG - Intergenic
1160833147 19:1112596-1112618 GGGCCTAGTGGGTGAGGAGGTGG - Intronic
1161108704 19:2456638-2456660 GGGGCTTAGGGGCCGGGCGGGGG - Intronic
1161213343 19:3079824-3079846 GGCCCTTGTGGGCCATGGGGCGG + Intergenic
1161238833 19:3210764-3210786 GGGCCTGGTGGGCCACGGGGAGG + Intergenic
1161267849 19:3373223-3373245 GAGCCAGAGGGGCCAGGAGGTGG - Intronic
1161277456 19:3426629-3426651 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1161301592 19:3545359-3545381 GGGCCTGGTGGGCCATGGGGAGG - Intronic
1161353918 19:3808839-3808861 GGGCCGGAGGGCCCAGGAGGTGG - Intronic
1161361999 19:3855693-3855715 GGGCCTGGTGGGTGAGGAGGAGG + Intronic
1161621410 19:5299214-5299236 GGGCCTTGTGGGCCACCAGGAGG - Intronic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162342817 19:10102220-10102242 GGGTCCTGTGGGCCCGGAGGAGG + Intronic
1162857085 19:13477008-13477030 GGGCCTTATGGGCTGCGGGGAGG - Intronic
1162894673 19:13758038-13758060 GTGCCTTGTGAGCCAGGGGGAGG - Intronic
1163123836 19:15233460-15233482 GGGCCTGTTGGGCCAGCAGGAGG - Intergenic
1163560847 19:18018589-18018611 GGGTCTTACGGGCCTGGAGAGGG - Intergenic
1164444844 19:28308179-28308201 GGGCCCCAAGGGCCAGGTGGAGG - Intergenic
1164918583 19:32071764-32071786 GCTCCTTCTGGGCCAGGAGCTGG + Intergenic
1165116636 19:33532954-33532976 GGGGCTCTGGGGCCAGGAGGTGG - Intergenic
1165778861 19:38420592-38420614 GGGTCTTATGGGCTAGGCTGGGG + Intronic
1166183225 19:41123118-41123140 GGACCTCATGGGCCATGTGGTGG - Intronic
1166224366 19:41385993-41386015 GGGCCTTGTAGGCCATGGGGAGG - Intronic
1167068224 19:47203152-47203174 AGCCCTTCTGGGCCAGGATGGGG - Intronic
1167111741 19:47466415-47466437 GGGTCCTATGGGGGAGGAGGAGG + Exonic
1167267615 19:48491373-48491395 GGGCCCTATGGGGCGGGAGGGGG - Intronic
1167358380 19:49017400-49017422 GGGTCTTGGGAGCCAGGAGGAGG + Intergenic
1167380358 19:49134708-49134730 GGCCCTGAGGGGACAGGAGGAGG + Intronic
1168094457 19:54106793-54106815 GGGCACTGTGGGGCAGGAGGTGG - Exonic
1168121336 19:54254062-54254084 GGGCCTGCTGGGTCAGGACGGGG + Exonic
1168124848 19:54277594-54277616 GGGCCTGCTGGGTCAGGACGGGG + Exonic
1168132878 19:54332221-54332243 GGGCCTGCTGGGTCAGGATGGGG + Intergenic
1168177138 19:54633955-54633977 GGGCCTGCTGGGTCAGGACGGGG - Exonic
1168195287 19:54770158-54770180 GGGAGATATGGGCCTGGAGGTGG + Intronic
1168201152 19:54816980-54817002 TGGAGTTATGGGCCCGGAGGTGG + Intronic
926797288 2:16629306-16629328 GGGCCTAGTGGGGAAGGAGGTGG + Intronic
928098502 2:28420646-28420668 GGGCCTAATGGACGAGGAGGAGG - Intergenic
928427827 2:31193212-31193234 AGGCCTGTTGAGCCAGGAGGCGG - Exonic
930200484 2:48548121-48548143 GGACCTCATGTGCCAGGATGTGG + Intronic
932740539 2:74287535-74287557 GGGGCTCATGGGCCTGGATGTGG - Intronic
933767575 2:85720523-85720545 GGGCCTTTTAGGCCAGGGGAAGG + Intergenic
934119803 2:88828247-88828269 GGGCCTGAGGGGCCATGCGGGGG + Intergenic
934494810 2:94787922-94787944 GGGACTTGTGCCCCAGGAGGGGG + Intergenic
935639242 2:105275077-105275099 GGAGCTTGTGGGCCTGGAGGAGG - Intronic
936029861 2:109062573-109062595 GGGGCTTTGGGGACAGGAGGGGG - Intergenic
936088736 2:109487700-109487722 GGGCCCTGTGGGCCTGGACGTGG - Intronic
936163276 2:110100785-110100807 GGGCCTGAGGGGCCATGCGGGGG + Intronic
936293875 2:111250010-111250032 GGGCCTGTGGGGCCAGGATGGGG + Intergenic
938063807 2:128270484-128270506 GGGCCTCAAGGGCCAGAGGGCGG + Intronic
938140388 2:128790229-128790251 AGGCCTTCAGGGGCAGGAGGAGG + Intergenic
940182660 2:150953540-150953562 GGACCTTCTGAGCCAGGAGAAGG - Intergenic
944483808 2:200182471-200182493 GGCCCTTTTGGGCCTGAAGGTGG - Intergenic
945211022 2:207382080-207382102 TGACCTTATAGGCCAGGAGACGG + Intergenic
948715081 2:239856016-239856038 TGGCCCTATCTGCCAGGAGGTGG + Intergenic
1168855145 20:1002656-1002678 TGTCCTTAAGGGCCAGAAGGAGG - Intergenic
1168871616 20:1134468-1134490 TTGCTTTATGGGCCAGGATGTGG + Intronic
1169092110 20:2867282-2867304 GGGCCATAGGGGTCAGGGGGTGG + Intronic
1170568772 20:17621375-17621397 GGGGCCTATGGGGCAGGAGGTGG - Intronic
1171421778 20:25022523-25022545 TGGCCATATGGGCCTGGAAGGGG + Intronic
1171885946 20:30652573-30652595 GGGACTTGTGCCCCAGGAGGGGG + Intergenic
1172023977 20:31935544-31935566 GGGCTTTCTAAGCCAGGAGGAGG + Intronic
1172389825 20:34559085-34559107 GGGCCTGATGGCCCCGGGGGTGG + Intronic
1172765590 20:37349038-37349060 GGGCCTTGTGGGCCCTGGGGAGG + Intronic
1175504676 20:59473084-59473106 GGGGCTTCTGAGCCAGGAGAAGG + Intergenic
1176096013 20:63344959-63344981 GGGGCTTTTGTGCCAGGAGTGGG - Exonic
1176416547 21:6478805-6478827 GGGCCTCATGGGCCATGGGAAGG - Intergenic
1179587730 21:42384351-42384373 TGTCCCTAGGGGCCAGGAGGTGG - Intronic
1179692047 21:43087140-43087162 GGGCCTCATGGGCCATGGGAAGG - Intergenic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1180170223 21:46054727-46054749 CGGCCATGTGGGCCAGGAGCTGG - Intergenic
1180786996 22:18553031-18553053 GGGCCCTCTGGGCAGGGAGGCGG - Intergenic
1181121344 22:20670029-20670051 GGGCCTCATGGGCCAGGCCTCGG + Intergenic
1181234744 22:21442275-21442297 GGGCCCTCTGGGCAGGGAGGCGG + Intronic
1181243906 22:21492556-21492578 GGGCCCTCTGGGCAGGGAGGCGG - Intergenic
1181316209 22:21972456-21972478 GTGCCTCGTGGGCCAGCAGGGGG + Intronic
1181623328 22:24105751-24105773 GGGGCTTTTGGGTGAGGAGGGGG - Intronic
1183190589 22:36319827-36319849 AGGCCATGTCGGCCAGGAGGGGG - Intronic
1183551679 22:38491047-38491069 GGGCCTGTTGGGAGAGGAGGCGG - Intronic
1183829023 22:40408336-40408358 GGGCCTTAAGGGCCGGGCAGAGG - Exonic
1183948013 22:41337802-41337824 GGGCTGGATGGGCCAGCAGGTGG - Intronic
1184333012 22:43837846-43837868 GGGGCTTATGTGACAGGATGAGG - Intronic
1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG + Intronic
1184667353 22:45996038-45996060 GGGCCTTATGTGCCAGGCCTGGG + Intergenic
1185010427 22:48309669-48309691 GTGCCTTCAGGGCCAGGGGGAGG - Intergenic
1185345401 22:50308433-50308455 GGTCCTTCAGGGCCAGGAGGTGG + Intergenic
949831941 3:8224110-8224132 GGGCCTAAGGGGACAGGAGTGGG - Intergenic
950421432 3:12901899-12901921 GGGGCTGATGTGCCTGGAGGAGG + Intronic
953037280 3:39224113-39224135 GGGCCTTGTGGGGCATTAGGAGG - Intergenic
953464369 3:43105933-43105955 GGGCCTCCTGGGCCAGAAGCTGG - Exonic
954219753 3:49145761-49145783 GGACCTTTTGGGCCAGGAGAGGG - Intergenic
954657890 3:52208166-52208188 GGGCTTTATGGGGCTCGAGGCGG + Exonic
956233785 3:67043972-67043994 GGAGCTTCTGGGCCAGGAGAAGG + Intergenic
957947744 3:87086891-87086913 GGGCCTTATAGGCCATAATGGGG - Intergenic
960807508 3:121598278-121598300 TGGCCTCATGGGCCAAGAGAAGG + Intronic
962966931 3:140364279-140364301 GGGCATTAAGGGCAAGGAGAAGG - Intronic
965066092 3:163850625-163850647 GGGACTTGTGGGGCAGGGGGTGG + Intergenic
965522045 3:169678030-169678052 GGGGCTTCTGGGCCAGTAGCAGG - Intergenic
968563546 4:1297288-1297310 CGGCCTTCGCGGCCAGGAGGAGG + Intronic
969067134 4:4494966-4494988 GGGCCTTATGGAGCAGGGTGGGG - Intronic
969295674 4:6269653-6269675 GGGCCCGAGGGGCCAGAAGGCGG - Intergenic
973369590 4:49234817-49234839 GGGACTTGTGCCCCAGGAGGGGG + Intergenic
973391441 4:49560599-49560621 GGGGCTTGTGCCCCAGGAGGGGG - Intergenic
977040960 4:92017674-92017696 GGGCATTAAGGGTGAGGAGGAGG + Intergenic
982280523 4:153679827-153679849 GAACCTTATGGTCCAGGAGCTGG + Intergenic
982282987 4:153704875-153704897 GAACCTTATGGTCCAGGAGCTGG + Exonic
982924664 4:161320558-161320580 GGTCCTTATCTGCCAGCAGGTGG + Intergenic
983484559 4:168318434-168318456 CGGCCTTCCGGGCCAGCAGGGGG + Intronic
990419520 5:55617592-55617614 TGGACTTCTGGGTCAGGAGGGGG + Intergenic
992306918 5:75450195-75450217 GGGTCCTCTTGGCCAGGAGGAGG - Intronic
992639854 5:78759911-78759933 GGACGTGATGAGCCAGGAGGAGG - Intronic
997051429 5:130385728-130385750 GGTTCTTCTTGGCCAGGAGGTGG - Intergenic
997838819 5:137219423-137219445 GGGCCTAATGAGCCAGGAATTGG + Intronic
998053204 5:139053557-139053579 GGGCCTCATGGACCAGGGTGAGG - Intronic
998406057 5:141875524-141875546 GGGGTTGAAGGGCCAGGAGGGGG - Intronic
999308266 5:150534819-150534841 GGGCCTCATGGCCCAGTGGGTGG + Intronic
999341826 5:150779320-150779342 GGGCCTGGAGAGCCAGGAGGTGG - Intronic
1001237489 5:170042493-170042515 GGGCCTCATGGGCCATGGGAAGG - Intronic
1001451567 5:171829070-171829092 GTGCCTTATGGGCCAGGATTGGG - Intergenic
1003198114 6:3932865-3932887 GGGTGCTATGGGCCAGGAGGTGG + Intergenic
1003977210 6:11355639-11355661 GGGGCGTATGTGGCAGGAGGAGG + Intronic
1006002716 6:30978167-30978189 GGGCGTTATGGACTTGGAGGAGG + Intergenic
1006010021 6:31034909-31034931 GGGCATTATGGACATGGAGGAGG + Exonic
1006034842 6:31202966-31202988 AAGGCTTATGGGCCAGGGGGTGG + Exonic
1009949774 6:70381945-70381967 AGACCTTATGGGACAGGATGTGG + Intergenic
1010253409 6:73731568-73731590 GGGCCTTATTGGCCATGATAGGG + Intronic
1011367419 6:86598470-86598492 GGACCTTTTGAGCCAGGAGAAGG + Intergenic
1011391205 6:86855271-86855293 GGGTGTTATGGGCCAGGAACTGG + Intergenic
1013533997 6:111046846-111046868 GTGCCTTGAAGGCCAGGAGGTGG - Intergenic
1015929527 6:138343908-138343930 TGGCATGATGGGGCAGGAGGAGG + Exonic
1016713975 6:147203651-147203673 GGGCCTGCTGGGCCAGGGTGGGG + Intergenic
1017158078 6:151340563-151340585 GAGCCTTATGGGCTAGAAGGTGG - Intronic
1018936370 6:168276306-168276328 GGGGCTGAGGGGACAGGAGGAGG + Intergenic
1019517712 7:1447088-1447110 GCCCCTAATGGGGCAGGAGGAGG - Intronic
1023727982 7:43163967-43163989 GGGCCTTGGGTGACAGGAGGTGG + Intronic
1027134033 7:75611787-75611809 GGGCCTGCTGGGTCAGGAAGTGG - Intronic
1027179714 7:75929920-75929942 GACCATTATGGGCCAGGAGTTGG + Intronic
1029692380 7:102190879-102190901 GGGGCTGATGGGACAGCAGGAGG - Intronic
1030552835 7:110986288-110986310 GGGCATCATGGGCCAGGGGTAGG - Intronic
1032077812 7:128844348-128844370 GGGACTTATGTGCCTGGAGTGGG + Intronic
1032864639 7:135913620-135913642 TGGCCTTGGGGGCAAGGAGGGGG + Intergenic
1035846940 8:2875276-2875298 GGGCATCTTGGACCAGGAGGAGG - Intergenic
1036427093 8:8654708-8654730 GGGACTTATGAGCCAGGAACTGG + Intergenic
1037638345 8:20720428-20720450 GGGCCTCAGGAGCCAGGAGAGGG - Intergenic
1039586199 8:38709146-38709168 GGGTATAATGAGCCAGGAGGAGG - Intergenic
1042626393 8:70762429-70762451 GTGGCTTATGGGACAGAAGGTGG - Intronic
1043935926 8:86142224-86142246 GTGACTTATGGGCCTAGAGGAGG + Intronic
1045695291 8:104802331-104802353 GGGTCCTATGGGCCAGGGGATGG + Intronic
1047024234 8:120809880-120809902 CTGCATTGTGGGCCAGGAGGTGG + Intronic
1049134718 8:140885802-140885824 GGGCATGATGGGACAGGATGGGG + Intronic
1049364763 8:142231852-142231874 GGGGCTTATGGGGCAGGGTGTGG - Intronic
1049519884 8:143082668-143082690 GGGCCAGCAGGGCCAGGAGGGGG - Exonic
1049680781 8:143917041-143917063 GGGGCTGATGGGGTAGGAGGAGG + Exonic
1050062054 9:1719669-1719691 GAGCCTTCTGGTCCAGGAGGAGG - Intergenic
1050365256 9:4868087-4868109 GGGTGTTGTGGGCCAAGAGGAGG + Intronic
1050896554 9:10890469-10890491 GGAGCTTATGAGCCAGGAGAAGG - Intergenic
1050898063 9:10909398-10909420 GGAGCTTCTGGGCCAGGAGAAGG - Intergenic
1052350173 9:27450378-27450400 GGGAGTTATGGGCCAGCAGAGGG + Intronic
1052911667 9:33888118-33888140 GTGCCTTATGGCCCAGAATGTGG + Intronic
1053291109 9:36880153-36880175 GGGCGTTCTGTGCCAGGATGTGG + Intronic
1053618011 9:39789199-39789221 GGGCTTTATGGCCCAGAATGTGG + Intergenic
1053662307 9:40292437-40292459 GGGACTTGTGCCCCAGGAGGGGG - Intronic
1053876190 9:42548564-42548586 GGGCTTTATGGCCCAGAATGTGG + Intergenic
1053896468 9:42746069-42746091 GGGCTTTATGGCCCAGAATGTGG - Intergenic
1053912758 9:42922604-42922626 GGGACTTGTGCCCCAGGAGGGGG - Intergenic
1054235506 9:62553158-62553180 GGGCTTTATGGCCCAGAATGTGG - Intergenic
1054266147 9:62918230-62918252 GGGCTTTATGGCCCAGAATGTGG - Intergenic
1054374435 9:64438666-64438688 GGGACTTGTGCCCCAGGAGGGGG - Intergenic
1054522303 9:66083847-66083869 GGGACTTGTGCCCCAGGAGGGGG + Intergenic
1055033989 9:71798507-71798529 AGGGCATATGGGCCAAGAGGTGG - Intronic
1057394103 9:94664211-94664233 GAGCCTTATGGGCCACAATGAGG + Intergenic
1059314967 9:113416492-113416514 GGGCCTTACAGGCCAGGAAAGGG - Intronic
1060155437 9:121316987-121317009 GGGCCATTTGGGACAGGGGGTGG + Intronic
1060374977 9:123109395-123109417 GAGCCTTAAGGGCCAGGAAAAGG + Intergenic
1060734345 9:126056854-126056876 TGGTGTTATGTGCCAGGAGGGGG - Intergenic
1061281563 9:129600656-129600678 GGGCCTAATCTGCCAAGAGGGGG + Intergenic
1062035688 9:134381601-134381623 GGGCCTTGTGGCCATGGAGGAGG - Intronic
1062444750 9:136588903-136588925 GGGCCTTGAGGGACAGGAAGGGG + Intergenic
1203710818 Un_KI270742v1:95485-95507 GGACCTTCTGAGCCAGGAGCGGG - Intergenic
1188331800 X:28881880-28881902 GGGACTTATGGGACATCAGGTGG + Intronic
1188334191 X:28908591-28908613 GTGCTTTATGGGCCAGAATGTGG + Intronic
1188776819 X:34230214-34230236 GGAGCTTATGAGCCAGGAGAAGG + Intergenic
1189152226 X:38720374-38720396 GGGCCTTATACACCAGGTGGAGG + Intergenic
1190221508 X:48515157-48515179 GGGCCTCATGGGCCATGGAGAGG + Intronic
1190328492 X:49221311-49221333 GGGCATTCTGGGCCAGGGTGAGG - Intronic
1190385784 X:49881020-49881042 TGGGCTCATGGGCCAGAAGGAGG - Exonic
1191105630 X:56770435-56770457 AGGCCTGTTGGGCCAGTAGGCGG - Intergenic
1191106623 X:56775837-56775859 AGGCCTGTTGGGCCAGTAGGCGG - Intergenic
1191613746 X:63145552-63145574 GGGTCTTTTGGGCCATGGGGGGG - Intergenic
1191622550 X:63233375-63233397 GGGTCTTTTGGGCCATGGGGGGG + Intergenic
1192361807 X:70445310-70445332 GACCCTTACGGGCCAGGTGGGGG + Exonic
1198537685 X:137602104-137602126 GGGCCTCATGGAACTGGAGGTGG - Intergenic
1199771434 X:150977750-150977772 GGGCCCTCTGTGCCACGAGGAGG + Intergenic
1200223817 X:154405520-154405542 GGGCCCCATTGGCCAGGATGAGG + Exonic
1200228184 X:154430946-154430968 GGACCTTGTAGGCCATGAGGGGG + Intronic