ID: 903486986

View in Genome Browser
Species Human (GRCh38)
Location 1:23697055-23697077
Sequence CCTTTTGAGCACTACGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903486986_903486992 -2 Left 903486986 1:23697055-23697077 CCAGCCACGTAGTGCTCAAAAGG 0: 1
1: 0
2: 1
3: 5
4: 51
Right 903486992 1:23697076-23697098 GGGGTTTCATTTTTGTGTTTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
903486986_903486991 -3 Left 903486986 1:23697055-23697077 CCAGCCACGTAGTGCTCAAAAGG 0: 1
1: 0
2: 1
3: 5
4: 51
Right 903486991 1:23697075-23697097 AGGGGTTTCATTTTTGTGTTTGG 0: 1
1: 0
2: 1
3: 41
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903486986 Original CRISPR CCTTTTGAGCACTACGTGGC TGG (reversed) Intergenic
901046146 1:6396918-6396940 CGTTGTGAGGACTACTTGGCAGG + Intergenic
903486986 1:23697055-23697077 CCTTTTGAGCACTACGTGGCTGG - Intergenic
905948910 1:41928687-41928709 CCTTTTGAAGAGTACTTGGCAGG + Intronic
911269337 1:95781396-95781418 ATTTTTGAGCACTATGTGCCTGG + Intergenic
921802760 1:219419930-219419952 CCTCATGAGCACTACCTGGTAGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1072649243 10:97281137-97281159 CCTTGTGAGGACAAGGTGGCAGG + Intronic
1079064656 11:17278842-17278864 CCTTTTGAGTACTGGGTAGCTGG + Intronic
1083278973 11:61613824-61613846 CCTTTAGAGGACTAGGGGGCTGG + Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1088287380 11:108202525-108202547 ACTTTTAAGAACTACCTGGCTGG - Intronic
1088893783 11:114063243-114063265 CCTTCTGGGCTCTGCGTGGCGGG - Exonic
1089935370 11:122359078-122359100 CATATTGAGCAGTACGTGGTGGG - Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1095441224 12:42240034-42240056 TTTTTTGAGCACTATGTGCCAGG + Intronic
1102833424 12:116029494-116029516 CCTTTTGTGCAATACGTAGATGG - Intronic
1107346696 13:39469246-39469268 CATTTTGAACACAAAGTGGCTGG - Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1117098923 14:52325391-52325413 CCTTTTCTGCACTTCTTGGCTGG + Intronic
1126857344 15:52851692-52851714 CCTTCTGAGAACTACTTGGCTGG + Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130240741 15:82186922-82186944 CCTTTTGAGCACTCCCTCACTGG + Intronic
1130960907 15:88658115-88658137 TCTTTTCAGCCCTGCGTGGCAGG - Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1139082496 16:63540197-63540219 CCTCTTGAGTACTATGAGGCAGG + Intergenic
1140779893 16:78285321-78285343 CCTTTGGAGGACTACTTGGGAGG + Intronic
1143679766 17:8467628-8467650 CCGTCTGAGCCCCACGTGGCAGG + Exonic
1159715776 18:71820686-71820708 GCTTCTGAGCAGTAAGTGGCCGG - Intergenic
925714698 2:6773258-6773280 CCTTTTGTGCTCAACGTGGCCGG + Intergenic
927637978 2:24829848-24829870 CGTATTGAGCACTACATGCCTGG - Intronic
930534423 2:52629422-52629444 CCTTTTCAGCACTAAGTACCAGG - Intergenic
937808320 2:126171308-126171330 CCTTTTGAGCGCAACCTGGTTGG - Intergenic
938647125 2:133343159-133343181 CCTTATGAGCACTGCCTAGCAGG - Intronic
946876294 2:224132974-224132996 CATTTTTAGCACTACATGCCAGG - Intergenic
1182077528 22:27505143-27505165 ACTTTTGAGAACCACGTGGCTGG - Intergenic
959255300 3:104003365-104003387 CATTTTCAGTACTATGTGGCTGG - Intergenic
966308125 3:178560712-178560734 ATTTTTGAGCACTACGTGTTGGG + Intronic
967328791 3:188269374-188269396 CCTTTTAAGTATTACCTGGCTGG + Intronic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
983237530 4:165196620-165196642 GCATTTTAGCACTAAGTGGCTGG + Intronic
1007144009 6:39609140-39609162 GCTCTTCAGCACTACTTGGCGGG + Intronic
1007298797 6:40850077-40850099 CCTGCTGAGCCCTAAGTGGCCGG - Intergenic
1013052946 6:106554832-106554854 CCTTTTGAGGATTATGTGTCAGG - Intronic
1013417137 6:109935034-109935056 ATTTTTGAGCACTATGTGTCAGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018632711 6:165834663-165834685 CCTATTCAGCACCACGTGGCTGG + Intronic
1020430630 7:8113271-8113293 CCTTTTGTCCTCTTCGTGGCTGG - Exonic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038284761 8:26196913-26196935 CATTTCCAGCACTACGTGCCAGG + Intergenic
1041799604 8:61784891-61784913 TGTTTTGAGCACTAAGTGTCAGG - Intergenic
1051793499 9:20836111-20836133 CCTTTGGAGCACTATGGGGTGGG + Intronic
1056558001 9:87706055-87706077 CCTTTAGTGCTCTAAGTGGCTGG + Intronic
1060560132 9:124535981-124536003 CCTCTTGAGCTCTACGTGGCAGG - Exonic
1060984712 9:127813445-127813467 CCTTTGGGGGACTAGGTGGCTGG - Exonic
1185799860 X:3000716-3000738 TCTTTTGATTACTACTTGGCTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic