ID: 903488299

View in Genome Browser
Species Human (GRCh38)
Location 1:23707884-23707906
Sequence GCCGCTGTGCAGGCTGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903488288_903488299 27 Left 903488288 1:23707834-23707856 CCAGGCAGTGTGAGAGGGCAAGA No data
Right 903488299 1:23707884-23707906 GCCGCTGTGCAGGCTGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903488299 Original CRISPR GCCGCTGTGCAGGCTGTGTA GGG Intergenic
No off target data available for this crispr