ID: 903492888

View in Genome Browser
Species Human (GRCh38)
Location 1:23743265-23743287
Sequence AGCCCCCAGCGCGCACACTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903492880_903492888 13 Left 903492880 1:23743229-23743251 CCGGCGGCGGAGGCGCGTACGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 903492888 1:23743265-23743287 AGCCCCCAGCGCGCACACTTGGG 0: 1
1: 0
2: 0
3: 4
4: 54
903492882_903492888 -10 Left 903492882 1:23743252-23743274 CCGAGCAGCCCCCAGCCCCCAGC 0: 1
1: 5
2: 25
3: 169
4: 1376
Right 903492888 1:23743265-23743287 AGCCCCCAGCGCGCACACTTGGG 0: 1
1: 0
2: 0
3: 4
4: 54
903492881_903492888 -9 Left 903492881 1:23743251-23743273 CCCGAGCAGCCCCCAGCCCCCAG 0: 1
1: 0
2: 16
3: 118
4: 931
Right 903492888 1:23743265-23743287 AGCCCCCAGCGCGCACACTTGGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903492888 Original CRISPR AGCCCCCAGCGCGCACACTT GGG Exonic
900288090 1:1911354-1911376 GGCCCCCGACGCTCACACTTGGG + Intergenic
903492888 1:23743265-23743287 AGCCCCCAGCGCGCACACTTGGG + Exonic
903652507 1:24930365-24930387 AGCCCCCATCGCGGGCACCTCGG + Intronic
1075885677 10:125896863-125896885 AGCCCCCAGCGCGGACTCTAGGG - Intronic
1077266320 11:1652496-1652518 AGCCCACAGAGTGCACGCTTTGG - Intergenic
1079208095 11:18435268-18435290 AGGCCCCAGCTCCCACACTGGGG - Intronic
1079328459 11:19514147-19514169 AGCCCCCAGCCTGCAGACCTAGG - Intronic
1080226417 11:29966218-29966240 AACCCCCAGAGAGCACACCTAGG - Intergenic
1087237196 11:95733213-95733235 AGCCCACAGATAGCACACTTGGG - Intergenic
1099905403 12:88764157-88764179 AGCCACCAGAGCTCACATTTAGG - Intergenic
1108184903 13:47878818-47878840 AGCCCCCAGAGCTCTCACCTTGG + Intergenic
1108706576 13:52993901-52993923 AGCCCCCAGCCCCCACCCCTGGG - Intergenic
1118242028 14:64069390-64069412 AGCACCCATTGCGCACACCTAGG + Intronic
1122603300 14:102931787-102931809 AGCACCCAGCGGGGGCACTTGGG - Intronic
1122738056 14:103855191-103855213 AGCCCACAGCGCCCTCTCTTAGG - Intergenic
1133604581 16:7373764-7373786 AGCCACCAGGCCCCACACTTTGG + Intronic
1138073493 16:54017491-54017513 AGCCCCCACCTTGCACTCTTAGG + Intronic
1141042063 16:80681284-80681306 AACCCCCAGTGCTCACCCTTGGG + Intronic
1146358998 17:32159255-32159277 AGTCCCCAGAGCCCACACCTGGG + Intronic
1151323500 17:73365375-73365397 AGCCCCCAGCGCTCCCAGCTCGG - Exonic
1161438944 19:4279761-4279783 AGCCCCCAGCGCGCGGGGTTCGG + Exonic
1161668060 19:5589085-5589107 AGCCCCCAGCGCGCACTGCCAGG + Intronic
925121473 2:1421863-1421885 TGTCCCCAGCACGCACACATTGG + Intronic
925412382 2:3647466-3647488 AACCCCCAGCGGCCACACTCTGG - Intergenic
926053835 2:9762110-9762132 AGCCCCCAGGAAGCACCCTTTGG - Intergenic
930086796 2:47503444-47503466 AGCCCCCAGCTCCCACAGTGAGG - Intronic
933747971 2:85584566-85584588 AGGCCCCAGCCCGCGGACTTTGG - Intronic
937941830 2:127292254-127292276 AGTCCCCAGCACACTCACTTTGG + Intronic
946247184 2:218394542-218394564 ATCTCCCAGCGCCCACACTGGGG - Intronic
946250198 2:218406754-218406776 AGCCCCCACCGCACACACCCAGG + Intergenic
948301402 2:236909794-236909816 AGCACCCAGCGTGCACACCAGGG - Intergenic
1170204283 20:13781649-13781671 AGCTCCCAGGGGTCACACTTTGG - Intronic
1175766197 20:61594398-61594420 AGCCCCCACCGGGCCCACCTGGG + Intronic
1176188497 20:63795009-63795031 AGCCCGCAGCACCCACTCTTTGG - Intronic
953759185 3:45673464-45673486 AGCCCACAGGCTGCACACTTGGG - Exonic
964645581 3:158955711-158955733 AGCACCCAGAGCCAACACTTTGG + Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
974052972 4:56958286-56958308 AGCACCCAGCGCGCAAGCTGAGG - Intergenic
984817964 4:183856111-183856133 AGACCCCAGGGTGCGCACTTAGG - Intronic
985799683 5:1996317-1996339 AGCCCCCACCGTGCCGACTTTGG - Intergenic
1002864507 6:1109024-1109046 AGCCCCCAGGAAGCTCACTTGGG + Intergenic
1004000785 6:11594888-11594910 TGTCCCCAGCGCTCTCACTTGGG - Intergenic
1007615315 6:43176378-43176400 AGCCCCCAGAGTGGATACTTGGG + Intronic
1008916263 6:56790864-56790886 AGTCCCCATTGCCCACACTTTGG + Intronic
1012997390 6:105986852-105986874 AGCCCCCCGAAAGCACACTTTGG + Intergenic
1022559855 7:31336675-31336697 GGCCCCCAGGGCGCCCACTGCGG + Intergenic
1024670025 7:51585805-51585827 AACCCCCAGGGCGCAGCCTTGGG + Intergenic
1029054944 7:97732253-97732275 CGCCCCCAGCGCGGCCACCTCGG - Intronic
1030647542 7:112079863-112079885 AGCCCCCAGAGGGCAGACTTAGG + Intronic
1036480804 8:9137825-9137847 AGCCCCCAGCCAGCACACCTGGG - Exonic
1038696038 8:29807272-29807294 AACCCCCAGAGCGCAATCTTGGG + Intergenic
1040988906 8:53328165-53328187 AGTCCCCAGCTCCCACACCTTGG + Intergenic
1047420796 8:124706708-124706730 AACCCCCAGGGCACACACTTGGG - Intronic
1047771489 8:128033638-128033660 AGGCCCCAGCCTGCACACTATGG - Intergenic
1059517235 9:114907361-114907383 AGCCCACAGCCCACACTCTTGGG + Intronic
1060525734 9:124320315-124320337 GGCCCCCAGGGCCCACACATGGG + Intronic
1062000997 9:134215593-134215615 AGCCCCCAGCCTGCCAACTTTGG + Intergenic
1186482202 X:9904530-9904552 AGCCCCCAGCGGCCTCTCTTGGG + Intronic
1189330984 X:40145189-40145211 CGCCGCCAGCACCCACACTTTGG + Intronic