ID: 903492894

View in Genome Browser
Species Human (GRCh38)
Location 1:23743271-23743293
Sequence CAGCGCGCACACTTGGGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903492880_903492894 19 Left 903492880 1:23743229-23743251 CCGGCGGCGGAGGCGCGTACGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 903492894 1:23743271-23743293 CAGCGCGCACACTTGGGCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 84
903492882_903492894 -4 Left 903492882 1:23743252-23743274 CCGAGCAGCCCCCAGCCCCCAGC 0: 1
1: 5
2: 25
3: 169
4: 1376
Right 903492894 1:23743271-23743293 CAGCGCGCACACTTGGGCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 84
903492881_903492894 -3 Left 903492881 1:23743251-23743273 CCCGAGCAGCCCCCAGCCCCCAG 0: 1
1: 0
2: 16
3: 118
4: 931
Right 903492894 1:23743271-23743293 CAGCGCGCACACTTGGGCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903492894 Original CRISPR CAGCGCGCACACTTGGGCCA GGG Exonic
900122455 1:1054624-1054646 CAGCGCCCACCCTTGAGTCAGGG + Intronic
901031404 1:6309064-6309086 CAGTGTGCACACCTGGGTCAAGG - Intronic
903492894 1:23743271-23743293 CAGCGCGCACACTTGGGCCAGGG + Exonic
904130578 1:28272595-28272617 CGGCGAGCACACTTGGTCCCTGG + Exonic
908392892 1:63699406-63699428 CAGCAGGCCCACATGGGCCAGGG - Intergenic
909530915 1:76681006-76681028 CAGAGAGCACACCTGGCCCATGG - Intergenic
910795276 1:91091549-91091571 CAGGGCGATCACTTGAGCCAAGG + Intergenic
915105999 1:153535518-153535540 GAGAGAGCACACTAGGGCCAAGG + Intronic
915464831 1:156090927-156090949 CAGCGCCCTCACTAGGGCCCAGG + Intronic
915571563 1:156747696-156747718 CAGTGCCCACACCTGAGCCAGGG + Intronic
918379245 1:183937912-183937934 CAGCGCGCAAACCCGGGACAGGG + Exonic
918588441 1:186214340-186214362 CAGGGCGCACACATGGTCCAGGG - Intergenic
922732569 1:227958747-227958769 CAGTGAGCACCCTTGGACCAGGG - Intergenic
1064175040 10:13067220-13067242 CATTGGGCACCCTTGGGCCATGG - Intronic
1071099881 10:82023354-82023376 CAGCCAGCACAATTGGGCAAGGG - Intronic
1072037257 10:91574943-91574965 CAGGGCTCAGCCTTGGGCCAGGG - Intergenic
1081330512 11:41794278-41794300 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1084605797 11:70170929-70170951 CAGCGCAAACAGTGGGGCCAGGG - Exonic
1085508039 11:77071256-77071278 CAGGCTGCACACTGGGGCCAGGG - Intronic
1090647543 11:128777843-128777865 CATCGGGGACACCTGGGCCAGGG - Intronic
1096747825 12:53739851-53739873 CATCGCGAACATTTGGGCCGTGG + Intergenic
1114049960 14:18914359-18914381 CAGTGGGCACACATGGTCCAGGG + Intergenic
1114112597 14:19487571-19487593 CAGTGGGCACACATGGTCCAGGG - Intergenic
1114522201 14:23346853-23346875 CAGCGCCTCCACATGGGCCATGG - Exonic
1121422116 14:93823634-93823656 CAGCACGCAGGCTTAGGCCAGGG + Intergenic
1122675838 14:103412565-103412587 CAGGACCCACACTTGGGACAGGG + Intronic
1123847927 15:24323186-24323208 CAGAGGGCACAGTTGGGCTAGGG + Intergenic
1125433814 15:39625207-39625229 CAGCCCGGGCACCTGGGCCACGG - Intronic
1139925573 16:70483995-70484017 CACCGAGCACGCGTGGGCCATGG + Intronic
1142968261 17:3594433-3594455 CAGAGCACACAACTGGGCCATGG + Intronic
1144642470 17:16945140-16945162 CAGCTGCCACACTTGTGCCATGG - Intronic
1145206615 17:20987825-20987847 CAGCTGCCACACTTGTGCCATGG + Intergenic
1147831185 17:43299290-43299312 CAGCGAGAACACATGGGACACGG + Intergenic
1152088024 17:78232022-78232044 CAGCGCGCCCAGCCGGGCCATGG - Exonic
1152780403 17:82225325-82225347 GAGGGCGCAGATTTGGGCCATGG + Intergenic
1152875968 17:82786403-82786425 CAGCACCCACACTCGGGGCAGGG - Intronic
1158930950 18:62325061-62325083 CAGCCCGAGCACCTGGGCCAGGG + Intergenic
1161222046 19:3122344-3122366 CAGCACTCGCACTTTGGCCAGGG + Exonic
1161438869 19:4279523-4279545 CCGCGCGCAAAGTTGGGCCGCGG - Exonic
1162013530 19:7831501-7831523 CAGCGCCCACACTGGAGCCTTGG + Intronic
1162386209 19:10361936-10361958 CAGCTGTCCCACTTGGGCCAGGG - Exonic
1165751826 19:38264891-38264913 CAGCCCGCACAGCTGCGCCATGG - Exonic
1166873858 19:45885771-45885793 CGGCGCGCGGACTGGGGCCATGG - Exonic
926300101 2:11596334-11596356 CACTGTGCACACTTGCGCCATGG - Intronic
927141660 2:20135172-20135194 CAGCTCCCACCCTGGGGCCATGG + Intergenic
929779757 2:44949927-44949949 GGGCCCGCACACTGGGGCCAGGG - Intergenic
934761418 2:96858964-96858986 CAGCGCCCACTGTGGGGCCAGGG - Intergenic
937975417 2:127579439-127579461 CAGACTGCACACTTCGGCCAGGG + Intronic
948565349 2:238882900-238882922 CAGGGGGCACACCTGGACCACGG - Intronic
1169907523 20:10618492-10618514 TAGCTCTTACACTTGGGCCAAGG - Intronic
1180468442 22:15636735-15636757 CAGTGGGCACACATGGTCCAGGG + Intergenic
1180948622 22:19710316-19710338 CAGGGGGCACACTAGTGCCAAGG + Intergenic
1183005643 22:34899405-34899427 CAGAGAGCACTCTAGGGCCATGG - Intergenic
1183086898 22:35492035-35492057 CAGGGAGCACACCTGGGGCAGGG - Intergenic
1183086916 22:35492123-35492145 CAGGGAGCACACCTGGGGCAGGG - Intergenic
1185001724 22:48250411-48250433 CAGGGCACTCACTGGGGCCAGGG - Intergenic
966734753 3:183179792-183179814 CAGCCCTCCCACCTGGGCCACGG + Intronic
967171616 3:186826896-186826918 CAGCCCTCCCACCTGGGCCACGG - Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
970007764 4:11427657-11427679 CAGGGCGCTCTCTTGGGCCAAGG - Intronic
972476919 4:39459140-39459162 CAGCCCGCACCCTGGGGCCCCGG + Exonic
972740510 4:41882239-41882261 CAGTGCGGATACTCGGGCCAGGG - Intergenic
980439260 4:132818548-132818570 GTGAGCGCACACTTGGGCAAGGG + Intergenic
983469752 4:168141919-168141941 CAGTGCGCATGCGTGGGCCAGGG + Intronic
987667705 5:20966062-20966084 CAGGGCAGACACTTGGGCCCAGG - Intergenic
992445953 5:76833684-76833706 CAGTGCGGACACTTCGGCAAAGG - Exonic
1002634916 5:180602536-180602558 CAGCCCGCACACCTGCGCCTGGG - Exonic
1002880848 6:1251095-1251117 CAGCCAGCACTCTTGGGCCCGGG + Intergenic
1004000779 6:11594882-11594904 CAGCGCTCTCACTTGGGCAGGGG - Intergenic
1011569967 6:88724978-88725000 GTGAGCGCACACTTGGGCAAGGG - Intronic
1012607685 6:101178140-101178162 CAGTGGGCACACTTGTGCTAAGG + Intergenic
1018191114 6:161309772-161309794 GTGAGCGCACACTTGGACCAGGG + Intergenic
1019611535 7:1939264-1939286 GCGCGCGCACACATGGGCCAGGG + Intronic
1025992048 7:66503989-66504011 CAGCACTTGCACTTGGGCCAGGG - Intergenic
1027729938 7:81858779-81858801 GTGAGCGCACACTTGGACCAGGG + Intergenic
1032731364 7:134646600-134646622 CAGCGGGCAGGCTTGGGCCTAGG - Intergenic
1035382480 7:158448614-158448636 CAGCTCCCACTCCTGGGCCAAGG + Intronic
1037709582 8:21345128-21345150 GAGGGCGCACACCTGGGCCCTGG + Intergenic
1049328918 8:142039302-142039324 TGGCGCAGACACTTGGGCCAGGG + Intergenic
1050913643 9:11104812-11104834 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1058054531 9:100436239-100436261 CAGGGTGATCACTTGGGCCAAGG - Intronic
1060559343 9:124530035-124530057 CAGAGTGAACACTTGGGGCAAGG - Intronic
1060989151 9:127838392-127838414 CAGCCCTCAGACTTGGGCAAAGG - Intronic
1061613183 9:131762344-131762366 ACGCTTGCACACTTGGGCCAAGG + Intergenic
1188263366 X:28042164-28042186 GAGCGCCCACACTGGGGACAGGG + Intergenic
1189471947 X:41321622-41321644 CAGCAGGGACACCTGGGCCAAGG - Intergenic
1189833067 X:44994702-44994724 GTGAGCGCACACTTGGGCAAGGG + Intronic
1192758171 X:74067262-74067284 CAGCAGGGACACCTGGGCCAAGG + Intergenic