ID: 903498377

View in Genome Browser
Species Human (GRCh38)
Location 1:23787501-23787523
Sequence TGGGGCTTGCTGCAGAAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903498376_903498377 -9 Left 903498376 1:23787487-23787509 CCAAGCTTTGTCTTTGGGGCTTG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198
903498371_903498377 3 Left 903498371 1:23787475-23787497 CCACAGCCTCTGCCAAGCTTTGT 0: 1
1: 0
2: 2
3: 36
4: 368
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198
903498370_903498377 20 Left 903498370 1:23787458-23787480 CCAGAGAGAGTTGGCTGCCACAG 0: 1
1: 0
2: 2
3: 15
4: 146
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198
903498372_903498377 -3 Left 903498372 1:23787481-23787503 CCTCTGCCAAGCTTTGTCTTTGG 0: 1
1: 0
2: 3
3: 18
4: 215
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903498377 Original CRISPR TGGGGCTTGCTGCAGAAACC TGG Exonic
900407000 1:2497150-2497172 TGTGGCATGCTGCCGACACCAGG + Intronic
900701843 1:4053417-4053439 TGGGGGTGGTTGCAGGAACCAGG - Intergenic
900909554 1:5585347-5585369 TGGGGCTTGCTCCTGACAGCAGG - Intergenic
901120759 1:6891240-6891262 TGGGGATTGCACAAGAAACCAGG - Intronic
901206752 1:7501943-7501965 TCAGGCTTGCTGCAAACACCAGG - Intronic
903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG + Exonic
907512903 1:54975550-54975572 TGGCGCTGGATGCAGAAAGCAGG - Intergenic
915218701 1:154356809-154356831 TGGGGTGTGCTGCAGAAGCAAGG - Intergenic
919712342 1:200739829-200739851 TGGGGGATGCTGCAGACCCCAGG + Exonic
921985325 1:221306124-221306146 CTGGGCTTGCTGCACCAACCTGG + Intergenic
922724004 1:227914260-227914282 TAGGACTTGCTGCAGAAGGCAGG + Intergenic
1064184896 10:13153126-13153148 TGGGGTGTGTTGCAGAAACCAGG + Intergenic
1064403581 10:15041088-15041110 TGGGGTTTGCTGCTGAAATTGGG - Intronic
1067063837 10:43092640-43092662 TGCAGCATGCTGCACAAACCTGG - Intronic
1069722184 10:70556888-70556910 TGGATCTTGCAGCAGAAACAAGG - Intronic
1074384425 10:113005667-113005689 TGAGGCTTGCTCCAGAAAGGTGG + Intronic
1076139586 10:128068626-128068648 GGGGGCTTCCTGTAGAAACCAGG - Intronic
1076981351 11:206644-206666 TGGGGCTTCCTGCAACACCCAGG + Intronic
1077360030 11:2136833-2136855 TGGGGCTTGTTGCGGAAGCGCGG - Intronic
1077497663 11:2894209-2894231 TGGGGCTGGCTGCAGAGTGCTGG + Intronic
1077506970 11:2934121-2934143 TGGGGATTGATTGAGAAACCAGG + Intergenic
1078430391 11:11283628-11283650 TGGGGCTTCGTGCAGAGACCTGG + Intronic
1079244001 11:18740123-18740145 TGGAGGCTGCTGCAGAAGCCAGG + Intronic
1080317833 11:30970419-30970441 TGTGGCTTGCTGCTGCCACCAGG + Intronic
1083959411 11:66006299-66006321 TGGGCCCTGCTGCAGTCACCTGG - Intergenic
1084147802 11:67274360-67274382 TGGGGCTTACTGCTGAAGCCCGG + Intronic
1084664465 11:70569116-70569138 GGGGCCTTCCTGCAGAATCCAGG - Intronic
1085459224 11:76683128-76683150 TGGGGCATGATGCAGGATCCAGG + Intergenic
1085985819 11:81786580-81786602 GGGGGCTTCATGCAAAAACCAGG - Intergenic
1090925610 11:131247461-131247483 ATGGGCTGGCTGCAGAAACCAGG + Intergenic
1091087286 11:132734226-132734248 TGGGGATTGCTGCAGAATAAGGG - Intronic
1092000919 12:5031552-5031574 TGGGGCCAGTTGTAGAAACCAGG - Intergenic
1092989906 12:13886658-13886680 TTGGGCAGGCTGCAGGAACCAGG - Intronic
1094615338 12:32031326-32031348 TGCATCTTGCTGCAGAACCCTGG + Intergenic
1096712419 12:53467065-53467087 TGGGGCTTGCATCACAATCCTGG - Intronic
1097241656 12:57579796-57579818 TGGGGCTTGCTCCATAGAGCAGG - Intronic
1097820861 12:64128000-64128022 CGGGGCCTGCTGCAGAACCGTGG + Exonic
1100015333 12:90003456-90003478 TGGGACTTGTTGCAGAAAGTTGG + Intergenic
1100609168 12:96176964-96176986 TAGGGTTTGCTGCAGATAACTGG + Intergenic
1101346488 12:103890746-103890768 TGGGCTTTCCTGCACAAACCTGG + Intergenic
1102495230 12:113314947-113314969 TTGGGCTAGAGGCAGAAACCTGG - Intronic
1102879059 12:116470282-116470304 TGGGGTTTGGAGCAGAAAGCAGG + Intergenic
1104919777 12:132284836-132284858 TGGAGGTTGGTGCAGGAACCCGG - Intronic
1105450758 13:20497183-20497205 TGGGGGGTGCTACAGATACCAGG + Intronic
1107933956 13:45329268-45329290 TCATGCTTGCTGCTGAAACCAGG - Intergenic
1109475420 13:62875000-62875022 AGGGGCTTGCTGAAGGAATCTGG - Intergenic
1110005895 13:70268086-70268108 TGGGGCTAGCTGCAGGAAAGTGG + Intergenic
1116285220 14:42962332-42962354 TGAGGCTTGCTGCAGAAACCTGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1121998831 14:98629183-98629205 TGGCGGAGGCTGCAGAAACCAGG + Intergenic
1125346581 15:38724676-38724698 TGGGGCCTGCTGGAGAATCGAGG - Intergenic
1128817947 15:70628178-70628200 TGGATGTTGCTGCAGAAAGCTGG + Intergenic
1129546830 15:76404571-76404593 TGCGGCATGCTGCAGAAATATGG + Exonic
1132029533 15:98428668-98428690 TGGGGCTCACTGCTGCAACCCGG + Intergenic
1133514845 16:6498489-6498511 TGGGGCTTGGTTCAGCAATCAGG + Intronic
1134691311 16:16192464-16192486 AGGGGCTTGCTGCTGTGACCTGG + Intronic
1135113037 16:19705439-19705461 TGAGGCTTGCTGTAGAGTCCAGG + Exonic
1136092780 16:27932619-27932641 TGGGGCCTGCTGCAGATGACTGG - Intronic
1136746428 16:32595756-32595778 TGAGGGTGGCTGCAGAAACCTGG - Intergenic
1138243319 16:55446522-55446544 TGGGGCTGGCTGCAGGAAACTGG - Intronic
1138291053 16:55847076-55847098 TGGGACTGGCTGCAGGAACACGG - Intronic
1139260249 16:65585363-65585385 AGGGTCTTGCTGTATAAACCAGG + Intergenic
1140394923 16:74618209-74618231 TTGGGCTTGCTCTAGAAAGCAGG - Intergenic
1141085910 16:81095814-81095836 GGCCGCTTGCTGCAGAAGCCAGG - Intronic
1141435771 16:83998980-83999002 AGAGCCTTGCTGCAGAAACGGGG - Intronic
1203048557 16_KI270728v1_random:854960-854982 TGAGGGTGGCTGCAGAAACCTGG - Intergenic
1142667986 17:1473372-1473394 TGTGGCTTGCTGGAGAGGCCTGG + Intronic
1143098111 17:4489290-4489312 TGGGGCTTGTTGCAGCCAACAGG - Intergenic
1144411841 17:15009300-15009322 TGGAGCTTAAAGCAGAAACCTGG - Intergenic
1144737543 17:17563462-17563484 TGCTTCTTGCTGCAGAATCCTGG - Intronic
1145057589 17:19713777-19713799 TGGGGCTTGCTGGGAAACCCGGG - Intronic
1146848579 17:36201885-36201907 AGGGGCTGGCTGCAGAAAGAAGG - Intronic
1148535232 17:48433119-48433141 TGGGGCTGACTGCTGAAACAGGG - Intergenic
1148870892 17:50658333-50658355 TGGGGCTTGGAGCAGGAACAAGG + Intronic
1149447012 17:56720989-56721011 TGGAGCTTGATCCAGAATCCAGG - Intergenic
1149651590 17:58279489-58279511 TGGGGGTGGCTGCAGGAACCGGG - Intronic
1150124294 17:62626929-62626951 TGGGGCTGCATCCAGAAACCTGG - Intergenic
1152465044 17:80461605-80461627 CGGGGGCTGCTGCAGAACCCGGG - Intergenic
1152476446 17:80521490-80521512 TGGCGGTTCCTGCTGAAACCAGG + Intergenic
1153811950 18:8759892-8759914 TGGGGCCCCCTGGAGAAACCGGG - Intronic
1153821441 18:8835409-8835431 TGGGCAGTGATGCAGAAACCAGG + Intergenic
1153983151 18:10329661-10329683 TGGGGCTGGCTGCAGAGCCCAGG - Intergenic
1156304124 18:35860708-35860730 TGTGACTAGCTGCAGAAACGAGG + Intergenic
1156582667 18:38395281-38395303 TGTGACTAGCTGCAGAAACGAGG + Intergenic
1157483961 18:48073820-48073842 TAGGGCTTTGTGCAGAAACTCGG - Intronic
1158537559 18:58322212-58322234 TGGGGCTGGCTCCTAAAACCCGG + Intronic
1159912515 18:74159877-74159899 TGTAGCTTGCTGAAGAAGCCCGG + Exonic
1160772634 19:839881-839903 TGGGGCGTACGGCATAAACCCGG - Intergenic
1161263022 19:3348005-3348027 TGGGGCCGGCTGCACTAACCTGG + Intergenic
1161585492 19:5103210-5103232 TGGTGCCTGCTGCAGAGAGCGGG - Intronic
1161588429 19:5117869-5117891 TGGGCCATGCTGCAGACATCGGG + Intronic
1161619874 19:5292409-5292431 AGGGGCTTCCTGCAGAACCCAGG - Intronic
1161748576 19:6077250-6077272 TGGGGCTTGCATCATTAACCTGG + Intronic
1162228407 19:9243964-9243986 TGGGGCCTTTTCCAGAAACCAGG - Intergenic
1162522430 19:11189690-11189712 TGGGGCTGGCTGCAGCAAGAGGG + Intronic
1163490482 19:17614732-17614754 TGGGGCGTGCAGCAAAGACCGGG - Intronic
1164150758 19:22548464-22548486 TGGGCCTGGCTGCAGAAAACGGG + Intergenic
1164279027 19:23752028-23752050 TGGGTCTTGCTACATAACCCAGG - Intronic
1166063072 19:40339376-40339398 TGTGGCTTGTTGCACACACCAGG + Intronic
1166086030 19:40475750-40475772 TGGCGCTGGCTCAAGAAACCTGG + Intronic
1166155384 19:40907926-40907948 TGGGGTTTTCTCCAGAGACCTGG - Intergenic
1166742604 19:45123327-45123349 TGGGTCTTCCTGCAGGCACCAGG + Intronic
1166781879 19:45347390-45347412 GGGGGCTTGTTTCAGAGACCGGG - Intronic
1167425647 19:49428444-49428466 TGGGGGCCGCTGCAGAAACCAGG - Intronic
1167430178 19:49449636-49449658 TTGGTCTTTATGCAGAAACCTGG + Exonic
1168713600 19:58514883-58514905 TGGGGCTTCCTGCAGGAAGGTGG - Intronic
928830122 2:35471785-35471807 GGAGGCATGGTGCAGAAACCAGG + Intergenic
928959869 2:36913090-36913112 AGAGGATTGTTGCAGAAACCTGG - Intronic
929763856 2:44828104-44828126 TTGGCCTTAGTGCAGAAACCAGG - Intergenic
929918588 2:46156164-46156186 CGGGGCCTGATGCAGAACCCTGG - Intronic
933793177 2:85899754-85899776 TGGGGCTTCCTGGAGAGGCCAGG + Intergenic
933809244 2:86022211-86022233 TGATGCTTCCAGCAGAAACCTGG - Exonic
936243500 2:110807540-110807562 TGTGGTTTGCTTCAGACACCTGG - Intronic
937539021 2:122925666-122925688 TGGGGCCTGCAGCAGCATCCAGG + Intergenic
938798420 2:134738151-134738173 TGGGGACTGCTGCAGCAGCCAGG - Intergenic
944387456 2:199181636-199181658 AGGAGCTTGCTTCAGAAATCTGG + Intergenic
1170696952 20:18667755-18667777 GGGGGCTTTCTGTGGAAACCTGG - Intronic
1172635583 20:36407714-36407736 TGGGCCTTGCTGCAGACCCAGGG + Intronic
1174523715 20:51154988-51155010 GGGGGCTTCCTGCAGAAAGAGGG + Intergenic
1174948020 20:55010172-55010194 TGGTGCTTGCTGAAGCCACCAGG + Intergenic
1175402054 20:58706618-58706640 TGGGGCTTGCTGGAGGTCCCTGG - Intronic
1175762586 20:61571563-61571585 TGGGTCTTTCTGCAGCAACAGGG + Intronic
1177463016 21:21437544-21437566 TGGGGATCCCTGCATAAACCGGG - Intronic
1177932720 21:27304719-27304741 TGGTGCTTGGTGCAGCAATCAGG - Intergenic
1179145153 21:38761581-38761603 TGGGGCTTTCTGCAGGAAGGTGG - Intergenic
1179150485 21:38805263-38805285 AGGCGCTTCCTGTAGAAACCGGG - Intergenic
1179913726 21:44463143-44463165 AGGGCCTCGCTGCAGAAGCCAGG + Intergenic
1183591702 22:38782862-38782884 CGGGGGGTGCTGCAGAAAACAGG + Exonic
1184035880 22:41917873-41917895 CGGGGCTTGCTGCAGATGCCAGG - Intergenic
1184889257 22:47369424-47369446 TGGGGCCTGCTGCAGAGATAAGG - Intergenic
1185214214 22:49589369-49589391 AGGTGTTTGCGGCAGAAACCGGG - Intronic
950448502 3:13052318-13052340 TGGGGCTGAGTGCAGAAAGCCGG - Intronic
950554625 3:13687902-13687924 TGGGGCAGCCTGCAGAAGCCAGG - Intergenic
952428240 3:33197168-33197190 TGGGGCTTGCTGCATAGGACTGG + Intronic
952579742 3:34818794-34818816 TGGGGCTTGTTGCAGGATCATGG + Intergenic
953221133 3:40972800-40972822 TAGAGTTTGCTGCAGAATCCTGG - Intergenic
953682704 3:45051812-45051834 TGGGGCCTTCTGCAGAGTCCTGG - Intergenic
954420453 3:50416356-50416378 TGGGGCTAGCAGCAGAGGCCCGG + Intronic
954964937 3:54602088-54602110 TATGGCTTGCTGCAGACACAGGG - Intronic
955294746 3:57724588-57724610 TGGGGGTGGATGCAGAAATCTGG + Intergenic
955777618 3:62450425-62450447 TAGGGCTTGCCCCAGATACCTGG + Intronic
956691113 3:71878318-71878340 AGGGGGCTGCAGCAGAAACCAGG + Intergenic
956836572 3:73100751-73100773 TGAGGCTTGAGGCAGAAAGCTGG - Intergenic
961462534 3:127061660-127061682 TGGGGCTTTCTGCAGATGTCTGG + Intergenic
966194241 3:177297768-177297790 TGGGTCTTCGTGCAGCAACCTGG + Intergenic
967419829 3:189260692-189260714 TAGGCCATGCTGCAGAAGCCAGG + Intronic
968258202 3:197298035-197298057 TGGGGCGTGCGGCAGCAACTGGG - Intronic
968914769 4:3492606-3492628 CGGGGCCTACAGCAGAAACCTGG - Intronic
969185257 4:5469694-5469716 TGAGGCTTGCTGCCCAAGCCTGG - Intronic
970145992 4:13036340-13036362 TTGTGCTTGCTGAAGAACCCTGG + Intergenic
972246791 4:37253393-37253415 TGTGGCCTGCTCCAGAAACAAGG + Intronic
977247605 4:94651733-94651755 TAGTTCTTGCTGCAGAAATCAGG + Intronic
977570725 4:98626640-98626662 TGGGGCTAGCTGCAGGAAAGCGG - Intronic
978727760 4:111990026-111990048 TGAGGCTTTCTGCAGAGAGCAGG - Intergenic
981565203 4:146093916-146093938 TGCTACTTGCTGCAGGAACCTGG + Intergenic
985951552 5:3225347-3225369 GGGGTCTTGCTCCAGGAACCAGG + Intergenic
986125663 5:4880597-4880619 CGGGGCTGACTCCAGAAACCAGG + Intergenic
987756956 5:22108853-22108875 TGGGGGTTGCTGAAAAAACCTGG - Intronic
994156323 5:96507578-96507600 TGGGAGATGCTGCAGAAATCAGG + Intergenic
996353109 5:122567518-122567540 TGGGGCTAGCTGGTGCAACCTGG + Intergenic
999276354 5:150333099-150333121 TGGGGCTGGCTGCAGAGCCAGGG + Intronic
999465889 5:151804032-151804054 GGAGGCATGGTGCAGAAACCAGG + Exonic
999714614 5:154350295-154350317 TGGGGCATGGTGCAGGATCCTGG + Intronic
999924604 5:156361087-156361109 TGGGGCCTGCAGCAGCACCCAGG - Intronic
1000155708 5:158549613-158549635 TTTGGCTTTCTGCTGAAACCTGG + Intergenic
1000752016 5:165108524-165108546 AGGGATGTGCTGCAGAAACCTGG - Intergenic
1001985925 5:176074417-176074439 TGGGGATGGCTGCAAACACCTGG - Intronic
1002230946 5:177763707-177763729 TGGGGATGGCTGCAAACACCTGG + Intronic
1002264392 5:178020041-178020063 TGGGGATGGCTGCAAACACCTGG - Intronic
1003088857 6:3084164-3084186 AGGAGCCTGCTGCAGAAACGAGG - Intronic
1003511090 6:6781271-6781293 TGAGGCTGGCAGCAGGAACCTGG + Intergenic
1005532063 6:26717897-26717919 TGTGGCCTGCTGCAGAAAGAGGG - Intergenic
1005538732 6:26783768-26783790 TGTGGCCTGCTGCAGAAAGAGGG + Intergenic
1007501076 6:42297393-42297415 TGAGGGTTTCTGCTGAAACCTGG + Intronic
1009009589 6:57826013-57826035 TGTGGCCTGCTGCAGAAAGAGGG + Intergenic
1010709321 6:79154140-79154162 TGGGGCTTGCTGAAAAAAGAAGG - Intergenic
1011993331 6:93551806-93551828 TGGCCATTGCTGCAGAAAACTGG - Intergenic
1013638192 6:112048584-112048606 TTGGGCTTGCAGTAGCAACCTGG + Intergenic
1017136019 6:151147990-151148012 TGGGGGTGGCTGCAGAAGGCCGG + Intergenic
1017405043 6:154110461-154110483 TAGGGCTAGCAGCAGAACCCAGG - Intronic
1019621739 7:1995812-1995834 AGGGGCTTGCTGCTGGCACCGGG - Intronic
1019728590 7:2617163-2617185 TGGGGCCTGCCTCAGGAACCTGG + Intergenic
1020030460 7:4929274-4929296 TCTGGCTTGCTGCAGAAGCCTGG - Intronic
1021558666 7:21946427-21946449 TGGGCCTTGGTAAAGAAACCTGG - Intergenic
1023741086 7:43281191-43281213 TGGGGCTTCCTGCAGTGACAGGG - Intronic
1023864777 7:44233493-44233515 TGGGGCTGGCTCCCGAAGCCTGG + Intronic
1024737034 7:52316769-52316791 TGGGTCTGGCTGCATAGACCTGG + Intergenic
1027774170 7:82443874-82443896 TGGGGGTGGCTGCAGGAATCGGG + Intergenic
1028632896 7:92955337-92955359 TGGGGCAAGCTGCAGACACGAGG - Intergenic
1034336758 7:150328910-150328932 TGGGACTTGCTTCACACACCAGG - Intronic
1034559790 7:151872589-151872611 TGAGGCATCCTGCAGAACCCAGG + Intronic
1036224217 8:6944461-6944483 GGGTGAGTGCTGCAGAAACCTGG + Intergenic
1036392854 8:8339565-8339587 TGAGGCTTTCTGCAGAGCCCTGG + Exonic
1039016212 8:33151985-33152007 TGGAGCTTGAATCAGAAACCTGG - Intergenic
1039440822 8:37594281-37594303 TGAGGCTTGCTGCAGCAAGCTGG - Intergenic
1040683526 8:49842539-49842561 TGGGCCTTGCGGCAGCAACTTGG - Intergenic
1042445255 8:68876942-68876964 TGGCGGTTGCTGATGAAACCTGG + Intergenic
1047407477 8:124597501-124597523 TGCCCCTTGCTGCAGAGACCTGG + Intronic
1047732492 8:127738183-127738205 GGGGTCTTGGTGCGGAAACCTGG - Intronic
1049220797 8:141427950-141427972 TGGGCCTTGCTGCAGAAACGGGG + Intronic
1052278234 9:26702917-26702939 TGGGAGCTGCTGCAGAAAGCTGG + Intergenic
1056804926 9:89721153-89721175 TAGGGCATGCTGGAGCAACCTGG + Intergenic
1057574744 9:96233162-96233184 TGGGCCTGGCTGCTGAAGCCTGG + Intergenic
1058414644 9:104774981-104775003 TGGGGTTGGCTGTAGAAAGCGGG - Intronic
1058420598 9:104829362-104829384 GGGGGCTTGCTTCAGTAACTAGG + Intronic
1062322227 9:135995926-135995948 TGGGGCTTCCTGCAAAGGCCAGG - Intergenic
1062608226 9:137358336-137358358 TGGGGCTCCGTGCTGAAACCAGG - Intronic
1186060437 X:5699529-5699551 TAGAGCTTCCTACAGAAACCAGG + Intergenic
1187050167 X:15687859-15687881 AGGGACTTGCTACAGAGACCTGG + Intergenic
1187058441 X:15762933-15762955 AGGGACTTGCTACAGAGACCTGG + Intronic
1189749097 X:44201019-44201041 TGAGACTTGCTTCATAAACCTGG - Intronic
1190575640 X:51834400-51834422 TGAGGCTTTCTGCAGAGAGCAGG - Intronic
1196035736 X:111142165-111142187 TGGGGTTTGATGCAGTCACCGGG + Exonic
1196892431 X:120304391-120304413 TGGGCCTTGCTGCAACCACCAGG - Exonic
1198330182 X:135615681-135615703 TGTGAGCTGCTGCAGAAACCAGG - Intergenic
1198336746 X:135673318-135673340 TGTGAGCTGCTGCAGAAACCAGG + Intergenic
1198362845 X:135913142-135913164 TGTGAGGTGCTGCAGAAACCAGG - Intergenic
1198378458 X:136062017-136062039 TGGGACTAGCTGAAGAAAGCAGG + Intergenic