ID: 903498377

View in Genome Browser
Species Human (GRCh38)
Location 1:23787501-23787523
Sequence TGGGGCTTGCTGCAGAAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903498371_903498377 3 Left 903498371 1:23787475-23787497 CCACAGCCTCTGCCAAGCTTTGT 0: 1
1: 0
2: 2
3: 36
4: 368
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198
903498372_903498377 -3 Left 903498372 1:23787481-23787503 CCTCTGCCAAGCTTTGTCTTTGG 0: 1
1: 0
2: 3
3: 18
4: 215
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198
903498370_903498377 20 Left 903498370 1:23787458-23787480 CCAGAGAGAGTTGGCTGCCACAG 0: 1
1: 0
2: 2
3: 15
4: 146
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198
903498376_903498377 -9 Left 903498376 1:23787487-23787509 CCAAGCTTTGTCTTTGGGGCTTG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG 0: 1
1: 1
2: 1
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903498377 Original CRISPR TGGGGCTTGCTGCAGAAACC TGG Exonic