ID: 903501907

View in Genome Browser
Species Human (GRCh38)
Location 1:23805123-23805145
Sequence CTGTAGGCCCAGATGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903501907_903501916 28 Left 903501907 1:23805123-23805145 CCTGCCTACATCTGGGCCTACAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 903501916 1:23805174-23805196 GGACCCTGAGCTCCTAGCCAAGG 0: 1
1: 0
2: 0
3: 20
4: 223
903501907_903501912 7 Left 903501907 1:23805123-23805145 CCTGCCTACATCTGGGCCTACAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 903501912 1:23805153-23805175 GTCCCTCATGCTGCCTGAGATGG 0: 1
1: 0
2: 0
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903501907 Original CRISPR CTGTAGGCCCAGATGTAGGC AGG (reversed) Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
907078880 1:51603031-51603053 CTGTAGTCCCAGTTATAGGGTGG + Intronic
907557171 1:55354126-55354148 CTTTGGACCCAGATATAGGCTGG + Intergenic
910709043 1:90159861-90159883 CTGTTTGCCCAGGTGTGGGCAGG + Intergenic
912551870 1:110490032-110490054 CTGTGGTCCTAGGTGTAGGCAGG + Intergenic
912876693 1:113366913-113366935 GGGTAGGCACAGATGTAGGTGGG + Intergenic
914203100 1:145503996-145504018 CTGCAGGCTCTGATGTTGGCTGG + Intergenic
914237029 1:145821923-145821945 CTGCAGGCTCTGATGTTGGCTGG + Intronic
914482222 1:148077150-148077172 CTGCAGGCTCTGATGTTGGCTGG + Intergenic
915300208 1:154947412-154947434 CTGCAGGCCCAGCTGCAGGTGGG - Exonic
915332622 1:155122797-155122819 CTGTAAGCCCAAATGTAAGCCGG + Intergenic
917296210 1:173522103-173522125 CTGTAGTCCCAGCTACAGGCTGG + Intronic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
921298404 1:213726206-213726228 CTGTAGTCCCAGATGTGCCCAGG - Intergenic
921360654 1:214328738-214328760 CTGAAGCCCAAGATGCAGGCAGG + Intronic
923666806 1:236005212-236005234 GAGAAGGCCCAGATATAGGCGGG + Intronic
924934533 1:248756861-248756883 ATGTCCACCCAGATGTAGGCTGG + Intergenic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1067533868 10:47093961-47093983 CTGTTGCCCCAGGTGAAGGCAGG - Intergenic
1069012147 10:63386318-63386340 CTGTTGGAGCAGCTGTAGGCAGG - Intronic
1073242377 10:102066876-102066898 CTGAAGGCCCAGCTGGTGGCTGG + Exonic
1074849397 10:117427048-117427070 CTGTATGTCCAGGTGAAGGCTGG + Intergenic
1076519617 10:131073505-131073527 TTGGAGGCCCTGATGGAGGCAGG - Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077068467 11:655952-655974 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
1077105364 11:839938-839960 CTGAAGAGCCAGATTTAGGCCGG - Exonic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1084929586 11:72543925-72543947 GGGTAGGCTCACATGTAGGCTGG - Intergenic
1085129737 11:74028121-74028143 CTGTGGGCCCAGCAGTGGGCAGG - Intronic
1087769447 11:102191791-102191813 CTGTAGTCCCAGCTACAGGCGGG - Intronic
1088167176 11:106952760-106952782 CTGTAGTCCCAGATATTGGGAGG - Intronic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089456256 11:118627692-118627714 CTGTAGGGCCAGATGGTAGCTGG - Exonic
1090376938 11:126296772-126296794 CTGTAATCCCAGACTTAGGCAGG - Intronic
1091318149 11:134630611-134630633 CTGGAAGTCCAGATTTAGGCTGG + Intergenic
1094162026 12:27401176-27401198 CTGTAGGCCCACATATGGTCAGG - Intronic
1095580655 12:43793107-43793129 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1095811679 12:46378667-46378689 CTGTAATCCCAGCTGTAGGGAGG - Intergenic
1100745915 12:97645604-97645626 CTGTAGGCACATATGTATTCTGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101630452 12:106488110-106488132 CTGTGGGCTCAGAAGCAGGCAGG + Intronic
1102032839 12:109752988-109753010 CTGCTGGCCCAGGGGTAGGCAGG - Intronic
1102765316 12:115427888-115427910 CTTTAGGCCCAGATCAAGGAGGG + Intergenic
1107421258 13:40248936-40248958 CTCTAGGCCCAGTGGTAGGAGGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1116645510 14:47523701-47523723 CTATAGGCTCACATATAGGCAGG - Intronic
1120787028 14:88547529-88547551 CTGTAGTCCCAGCTCTTGGCAGG + Intronic
1122567898 14:102674935-102674957 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124168387 15:27350123-27350145 CTGAAGGCCAAGATGGTGGCTGG - Intronic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124456270 15:29845680-29845702 CTGTAGCCCCAGCTGTCGGGAGG + Intronic
1124648852 15:31460256-31460278 CTGTAGTCCCAGCTGGTGGCGGG - Intergenic
1124862345 15:33454611-33454633 ATGTAGTCCCAGAAGTATGCAGG + Intronic
1128237053 15:66075282-66075304 CTGTAAGCCCAGATCTGTGCTGG - Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128878974 15:71225663-71225685 CTGTAGTCCCAGCTATAGGCTGG - Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1131853088 15:96563565-96563587 CTTTAGCCCCAGAGGTTGGCTGG + Intergenic
1132509658 16:332452-332474 CTGTAGTCCCAGCTCTAGGGAGG + Intronic
1132773496 16:1578484-1578506 CTGTAGTCCCAGATGCTTGCAGG + Intronic
1135459908 16:22633214-22633236 CTGTAGGCCCAGCTACAGGGAGG - Intergenic
1140026057 16:71291355-71291377 CTGTAGTCCCAGCTCTAGGGAGG + Intergenic
1140143750 16:72285563-72285585 CTGTAGCCCCAGAGGTAGAGCGG + Intergenic
1141658841 16:85430774-85430796 CTCCAGGCCCTGATGGAGGCGGG - Intergenic
1141851454 16:86649123-86649145 CTGTTGGCCCAGATTAAGCCTGG + Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1146118822 17:30170876-30170898 CTGCTGGTGCAGATGTAGGCTGG - Intronic
1146565878 17:33912368-33912390 CTGTAGTCCCAGCTACAGGCAGG + Intronic
1146716552 17:35090915-35090937 CTGTAGACCCAGCTATAGGGTGG - Intronic
1147589050 17:41669525-41669547 CTCTAGGCCCAGCTGGGGGCTGG + Intergenic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148898791 17:50859057-50859079 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1152163353 17:78683645-78683667 CTCTAGGCCCAGTTGAAGGTGGG - Intronic
1152687629 17:81702463-81702485 CTGATGGCCCAGCTGCAGGCAGG + Intronic
1153831058 18:8923014-8923036 TTCTCTGCCCAGATGTAGGCTGG - Intergenic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1154218626 18:12433545-12433567 CTGTAGTCCCAGCTGTCGGGAGG - Intergenic
1155320509 18:24614184-24614206 CTGCAGGGCCAGCTGTAGGAGGG + Intergenic
1156588763 18:38462264-38462286 ATCTAGGCCTAGATGAAGGCAGG - Intergenic
1157495754 18:48156113-48156135 CTGTAGGCGCATTTGTAAGCTGG - Intronic
1158007206 18:52686323-52686345 CTGTTGGAACAGAGGTAGGCTGG - Intronic
1160987701 19:1847038-1847060 CTGTAGGCACAGCTGTCGGCAGG + Intronic
1161161436 19:2763662-2763684 CCGTAGGCCTTGCTGTAGGCCGG + Exonic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1162437044 19:10667375-10667397 CTGTAGTCCCAGCTATAGGGAGG - Intronic
1166214504 19:41326383-41326405 CTGTGTTCCCACATGTAGGCTGG - Intronic
1168645452 19:58056400-58056422 CTGTAGGACCTGTTGTATGCTGG - Intergenic
926019519 2:9482963-9482985 CTGCAGGCCCAGAAGCAAGCTGG - Intronic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
930158936 2:48133161-48133183 CTGTAGTCCCAGCTGTACTCGGG + Intergenic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
935905206 2:107831691-107831713 CTGTAGTCCCAGCTACAGGCTGG - Intronic
935991572 2:108723395-108723417 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936126989 2:109796761-109796783 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936217708 2:110574725-110574747 CTGTAGTCCCAGCTACAGGCTGG + Intronic
936308204 2:111360744-111360766 CAGTTGGTCCAGAGGTAGGCAGG - Intergenic
936426850 2:112429296-112429318 CTGTAGTCCCAGCTACAGGCTGG + Intronic
936965440 2:118123444-118123466 CTGTAGGGCCCAAAGTAGGCAGG + Intergenic
938892011 2:135715224-135715246 CTGTAGTCCCAGCTACAGGCTGG + Intronic
938985487 2:136571343-136571365 CTGTTGGGCCAGATTTGGGCAGG - Intergenic
940119218 2:150244669-150244691 CTGTAGTCCCAGCTGTCGGGAGG + Intergenic
942458781 2:176155580-176155602 CTGTGGGCCCAAATGGATGCTGG - Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
945180647 2:207087727-207087749 CTGCAGGCCAAGGTGAAGGCAGG - Intronic
946716784 2:222561281-222561303 CTGCAGGGGCAGATGAAGGCTGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948893532 2:240918071-240918093 CAATAGGCCCAGAAGTGGGCAGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169494892 20:6105741-6105763 CTGTAGGCCAAGAACTAAGCTGG - Intronic
1170649755 20:18228517-18228539 CTGTAGTCCCAGTTGATGGCGGG - Intergenic
1171073324 20:22097197-22097219 CTGTAGACCCAGCTATAGGGAGG + Intergenic
1174021609 20:47534791-47534813 CTGTAGTCCCAGCTGTTGGGTGG + Intronic
1175433011 20:58920365-58920387 CTGTAGTCCCAGCTATAGGGAGG + Intergenic
1175798898 20:61789704-61789726 ATGCAGGCCCAGAGTTAGGCAGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181014417 22:20061056-20061078 CAGTGGGCACAGGTGTAGGCTGG - Intronic
1181974552 22:26719711-26719733 CTGTAGTCCCAGTTACAGGCTGG + Intergenic
1183196239 22:36355556-36355578 CTGTGGGCCAAGTTCTAGGCTGG + Intronic
1183670786 22:39271277-39271299 CTGGAGGCCCAGGTCTCGGCAGG + Intergenic
1185373368 22:50470948-50470970 CTGGAGGCCAAGATGTGGCCTGG - Intronic
953018237 3:39098178-39098200 CATGAGGCCCAGATGTGGGCAGG - Exonic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
954006836 3:47597915-47597937 CTTTGGGAACAGATGTAGGCTGG + Intronic
954160783 3:48720246-48720268 CTGTAGTCCCAGGTGTAGCGTGG + Intronic
956665152 3:71635417-71635439 TTGCAGCCCCAGATGTAGGCAGG - Intergenic
957478701 3:80761458-80761480 CTGTAGTCCCAGTACTAGGCAGG + Intergenic
962236658 3:133712741-133712763 TTGTAAGCCCATATGTGGGCAGG - Intergenic
964124170 3:153218540-153218562 CTGTAGCCCCAGATGTGAGAGGG + Intergenic
968938057 4:3623970-3623992 CTGTGGGAGCAGATGTGGGCGGG + Intergenic
969590791 4:8120834-8120856 GTGTGTGCCCAGCTGTAGGCTGG - Intronic
969597489 4:8157585-8157607 CTGTAGGCCTAGAAGGGGGCGGG - Intronic
972533497 4:39980615-39980637 CTGTAGTCCCAGATCTTGGGAGG - Intergenic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
980539662 4:134177296-134177318 CTGTAGTCCCAGCTGTTGGGAGG - Intergenic
982019871 4:151192064-151192086 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
983008462 4:162515760-162515782 CAGTAGGCCCAGAGGAGGGCTGG + Intergenic
986564306 5:9096110-9096132 CTGTTGGTGGAGATGTAGGCCGG - Intronic
987026028 5:13927367-13927389 CTGTAGTCCCAGCTACAGGCTGG + Intronic
992237260 5:74723712-74723734 CTGTAGTACCAGATGAAGGCAGG - Intronic
992273710 5:75092258-75092280 ATGTAGGCTAAGCTGTAGGCAGG + Intronic
997530172 5:134577110-134577132 CTGTAGACCTGGATGGAGGCTGG + Intronic
999681048 5:154060476-154060498 CTGTAGTCCCAGCTACAGGCAGG - Intronic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1006354487 6:33546676-33546698 CTGTAGTCCCAGATACAGGCAGG - Intergenic
1006990887 6:38213858-38213880 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1007620446 6:43210231-43210253 CTGTAGTCCCAGACTTTGGCAGG - Intronic
1008899187 6:56591831-56591853 CTGTAGTCCCAGCTGGTGGCGGG + Intronic
1009319667 6:62271620-62271642 CAGTAGGACAAGATGTAGGGTGG + Intronic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1013647978 6:112163958-112163980 GTGTGGGCACAGATGCAGGCGGG + Intronic
1016359784 6:143254913-143254935 CTGTAGTCCCAGCTGTCGGGAGG + Intronic
1017696143 6:157018336-157018358 CTGTAGTCCCAGCTGTTGGGAGG - Intronic
1021553995 7:21901165-21901187 CTGAAGGTCCAGATGTAGCTGGG - Exonic
1023279524 7:38555291-38555313 CTGTAGTCCCAGCTGTGGGTAGG + Intronic
1023507716 7:40917989-40918011 CTGAAGGCCTAGATATAGGAGGG + Intergenic
1028611133 7:92712979-92713001 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1029132617 7:98344053-98344075 CTGTAGTCCCAGCTATAGGGAGG + Intronic
1031476394 7:122227829-122227851 CTGTAGTCCCATATTTAGGAGGG - Intergenic
1035349850 7:158238237-158238259 CTCCAGGCCCAGCTGTAGGGAGG - Intronic
1037894065 8:22640300-22640322 CTGTAGTCCCAGCTGTACGTGGG - Intronic
1040032124 8:42834511-42834533 CTGTAGTCCCAGATGTGCTCAGG - Intergenic
1041477101 8:58278799-58278821 CTGGAGCTCCAGATGCAGGCAGG - Intergenic
1042964901 8:74339862-74339884 GTGAAGGCCCAGATGTAATCAGG + Intronic
1044664879 8:94624653-94624675 CTGTAGCCCCAGCTGTGGGGAGG + Intergenic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1044821243 8:96157577-96157599 CTGCTGGCCCAGCTCTAGGCGGG + Intronic
1052936714 9:34099352-34099374 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1053030928 9:34777371-34777393 CTCTAGGCCCACAGGTAGCCTGG + Intergenic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1053929859 9:43107523-43107545 CTGTAGTCCCAGCTGTACTCGGG - Intergenic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1055607421 9:77985185-77985207 CTGTAGTCCCAGCTATAGGCTGG + Intronic
1056634540 9:88320658-88320680 CTGTAGGTCCAGAGTTGGGCAGG - Intergenic
1057135702 9:92686354-92686376 CTGTAGTCCCAGCTCTAGGGAGG - Intergenic
1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG + Intergenic
1059061889 9:111041654-111041676 CTGTAGTCCCAGCTGTTGGGAGG + Intergenic
1059464893 9:114462201-114462223 CTGTAGACCCAGCTACAGGCAGG - Intronic
1061543047 9:131288625-131288647 CTGCTCGCCCAGATGAAGGCAGG - Intergenic
1061667801 9:132170457-132170479 CTGCAGGCCGAGAAGGAGGCAGG + Intronic
1061782193 9:133002896-133002918 CTGTAGCTCCAGCTGTCGGCAGG - Intergenic
1062265108 9:135683415-135683437 CCGTAGGACCAGATGTTTGCTGG + Intergenic
1062521946 9:136961601-136961623 CAGCAGGCCCAGATGGTGGCCGG - Intergenic
1187952390 X:24483964-24483986 CTGTAATCCCAGTGGTAGGCCGG - Intronic
1189280311 X:39816387-39816409 CTGTGGGCCTAGAGGCAGGCAGG + Intergenic
1192467149 X:71365589-71365611 CTGTAGTCCCAGCTGTTGGGGGG - Intergenic
1194914843 X:99693267-99693289 CTCTACACCCAAATGTAGGCTGG - Intergenic
1196832837 X:119789710-119789732 CCATAAGCCCAGATGTGGGCTGG + Intronic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1202196895 Y:22306514-22306536 CGGCAGACCCAGATGTTGGCCGG - Intergenic