ID: 903503909

View in Genome Browser
Species Human (GRCh38)
Location 1:23819278-23819300
Sequence CAAGTTCTCAAGGGCCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903503904_903503909 0 Left 903503904 1:23819255-23819277 CCTTGGCCACACTAGTCACATCT 0: 1
1: 0
2: 4
3: 24
4: 253
Right 903503909 1:23819278-23819300 CAAGTTCTCAAGGGCCACATGGG 0: 1
1: 0
2: 1
3: 21
4: 190
903503905_903503909 -6 Left 903503905 1:23819261-23819283 CCACACTAGTCACATCTCAAGTT 0: 1
1: 0
2: 2
3: 42
4: 229
Right 903503909 1:23819278-23819300 CAAGTTCTCAAGGGCCACATGGG 0: 1
1: 0
2: 1
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903503909 Original CRISPR CAAGTTCTCAAGGGCCACAT GGG Intronic
903101148 1:21030765-21030787 CAAGTGCTCAAAAGCCACAGTGG + Intronic
903503909 1:23819278-23819300 CAAGTTCTCAAGGGCCACATGGG + Intronic
905529391 1:38664643-38664665 CAATTGCTCAATAGCCACATGGG - Intergenic
906776010 1:48530169-48530191 CAGGTTCTCACTAGCCACATGGG + Intergenic
912384622 1:109265105-109265127 CAGGGTCAGAAGGGCCACATAGG + Intronic
913443570 1:118925607-118925629 TCAGTTCTAAAGGACCACATGGG + Intronic
914244240 1:145873761-145873783 CTGGTTCTCAAGGTCCAGATAGG + Exonic
914755144 1:150558110-150558132 CAACTTCCCAATGGCCACAGAGG - Exonic
917867769 1:179213631-179213653 CAAGTGCTCAAGAGCCACAGTGG + Intronic
918227164 1:182494403-182494425 CAAGTGCTCAGTGGCCACATGGG - Intronic
918713803 1:187764730-187764752 CAAGCAATCAAGGGCCACATAGG - Intergenic
919864107 1:201766368-201766390 GGAGTTCTCTAGGGCCACATGGG + Intronic
920287704 1:204892569-204892591 CAAGTGCTCAATAGTCACATGGG - Intronic
923039114 1:230307273-230307295 CCAGTGCTGAAGGGCCTCATGGG - Intergenic
924405357 1:243739527-243739549 CAAGTGCTCAACAGCCACTTTGG + Intronic
1065883357 10:30057253-30057275 CAAGTTCTCACTGGCCAGTTTGG - Intronic
1067791877 10:49294511-49294533 CAAGTGCTCATTAGCCACATAGG + Intergenic
1069515661 10:69075076-69075098 CAAGTTTTTAACAGCCACATGGG + Intergenic
1070043125 10:72802028-72802050 CAATTCCTCAAAGACCACATAGG - Intronic
1070451343 10:76560511-76560533 CAAGTGGTCAAAGGTCACATTGG - Intergenic
1070818595 10:79341242-79341264 CTTGTTCTCAAGGGCCATGTGGG + Intergenic
1073146578 10:101285468-101285490 CAACTCCTCAAGGACCACATAGG + Intergenic
1073702898 10:105949931-105949953 TAAGTTCTCAAAGCACACATTGG - Intergenic
1075302259 10:121335470-121335492 CAGGATCTTATGGGCCACATGGG - Intergenic
1075335572 10:121606797-121606819 CAAGTGCTCAACAGTCACATGGG + Intergenic
1077571003 11:3338695-3338717 CAAGGTCGCAGTGGCCACATGGG + Intergenic
1080610340 11:33898714-33898736 AAAGTGCTCAATAGCCACATGGG + Intergenic
1080759481 11:35234490-35234512 AGATTTCTCAATGGCCACATTGG + Intergenic
1085133067 11:74058889-74058911 CAAGTGCTCGATAGCCACATGGG + Intronic
1085494946 11:76960574-76960596 CAAGTGCTCAGTAGCCACATTGG + Intronic
1086169639 11:83821218-83821240 CAAATTCCCAAGGGCAGCATTGG - Intronic
1086210737 11:84315451-84315473 TAAATTCTCAAGGCTCACATAGG - Intronic
1087058487 11:93956331-93956353 CAAGATCTCAAAAGCCACAAGGG - Intergenic
1090004198 11:122985446-122985468 CAGGTGCTCAATAGCCACATAGG + Intergenic
1091406303 12:211563-211585 CCAGTGCTCAAGGCCCCCATGGG - Intronic
1092513386 12:9182288-9182310 AAAGTTCTGAAGGGAGACATTGG - Intronic
1093463046 12:19423643-19423665 CAGCTGCTGAAGGGCCACATAGG + Intronic
1095172331 12:39050609-39050631 TAAGTGTTCAATGGCCACATGGG + Intergenic
1095449506 12:42315082-42315104 CAAGTTCTCAGTAGCCACATTGG - Intronic
1101232862 12:102759077-102759099 CGAGTGCTCAAGAGCCACATGGG + Intergenic
1103029492 12:117601128-117601150 CAAGTTCTTAAGTTCCTCATAGG + Intronic
1103126328 12:118425782-118425804 TGACTTCTCAAGGGCAACATTGG - Intergenic
1104978178 12:132561353-132561375 CAAGCTCCCCAGGGCCACAAGGG - Intronic
1106313510 13:28574394-28574416 CAAGTCCTCAAGTGTCACACAGG + Intergenic
1108474788 13:50803489-50803511 CAAGTGTTCAAGAGCCACATGGG - Intronic
1108578933 13:51812207-51812229 CATGTTATGCAGGGCCACATGGG - Intergenic
1110240512 13:73261197-73261219 CAAATGCTCAACAGCCACATGGG - Intergenic
1110555245 13:76852457-76852479 CAAGTGCCCAATAGCCACATTGG + Intergenic
1112534146 13:100233587-100233609 CATGTTCTCAAAGACCATATTGG + Intronic
1113035735 13:106046657-106046679 CAACTTCTCAAATGCTACATTGG + Intergenic
1115416407 14:33139757-33139779 CAAGTGCTTATTGGCCACATGGG + Intronic
1115674193 14:35650905-35650927 CAAGTGCTCAATAGCCATATGGG - Intronic
1115714816 14:36091598-36091620 CATGTTCTCATTGGCAACATGGG + Intergenic
1115776601 14:36722088-36722110 CAGGTGCTCAATGGCCACGTGGG - Intronic
1116080864 14:40169875-40169897 CAAGTGTTCAATAGCCACATTGG - Intergenic
1117438381 14:55739038-55739060 CAAGTGCTCAGTAGCCACATGGG - Intergenic
1124353259 15:28975794-28975816 CCATTTCTCATGGGCCATATTGG + Intronic
1125522037 15:40353685-40353707 CATGTTCTGAAGTGCCCCATTGG - Intronic
1126310655 15:47312887-47312909 CAAGTACTCAGTTGCCACATGGG + Intronic
1127215970 15:56823489-56823511 CAAGTTTTCAGAAGCCACATGGG + Intronic
1127675615 15:61235531-61235553 CAAGTACTCAATAGCCACGTTGG - Intergenic
1128787691 15:70410413-70410435 AAAGTTCTCTGTGGCCACATGGG - Intergenic
1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG + Exonic
1137717812 16:50609555-50609577 GAAGTTCTCAAGGGGAGCATCGG + Intronic
1137791116 16:51175616-51175638 CGAGTTATCAAGGATCACATAGG + Intergenic
1138876701 16:60960057-60960079 CAAGTTCTAAGAGGCCAAATAGG - Intergenic
1140302633 16:73773174-73773196 CAAATGCTCAATGGCCACAGTGG + Intergenic
1141643015 16:85352457-85352479 CATGTTCTCCAGGGCCCCCTGGG + Intergenic
1141890846 16:86925562-86925584 CAGGTTCTCAACAGCCAGATTGG + Intergenic
1142513830 17:413955-413977 TAAGTTCTCAGGGGCCTCCTCGG - Exonic
1143128391 17:4659723-4659745 CAAATTCTTAATGGCAACATTGG + Intergenic
1145738928 17:27255819-27255841 TCAGTTCTCAAGATCCACATTGG + Intergenic
1150318748 17:64192047-64192069 CAAGTGTTCAAAAGCCACATGGG + Intronic
1150319428 17:64199766-64199788 CAAGGGCTCAACAGCCACATAGG + Intronic
1151529164 17:74693368-74693390 CAAGTTCTCAGGGGATCCATGGG - Intronic
1151860224 17:76755476-76755498 TAAGTACTCAAGGGCCATAAGGG - Intronic
1152684964 17:81689419-81689441 CTAGTTCTCCACGGCCACAATGG - Intronic
1153428511 18:4991064-4991086 CAATTTTTCAAGGGCCATCTGGG - Intergenic
1156833584 18:41525462-41525484 AAAGATCTCAAGGGCCAAAGTGG + Intergenic
1157925977 18:51766763-51766785 CAAGTTCTTAATGGCCGCTTTGG + Intergenic
1158287721 18:55903272-55903294 CAAGTACTCAGTAGCCACATAGG - Intergenic
1161781008 19:6291937-6291959 CAATTTGGCGAGGGCCACATGGG + Intergenic
1162390972 19:10390087-10390109 CAAGTGCTCAAGGGCCAGCATGG + Intergenic
1164434206 19:28215000-28215022 AAAGTCCTCATGGGCCAGATGGG - Intergenic
1165363533 19:35350903-35350925 GCAGTTCTCAGGGGCCACCTGGG - Intergenic
1165365677 19:35363362-35363384 GCAGTTCTCAGGGGCCACCTGGG - Intergenic
1165802814 19:38563215-38563237 CAGGTGCTCCAAGGCCACATGGG - Intronic
1166015227 19:39974470-39974492 CAGGTCCTCAAGGTCCCCATGGG - Intronic
1166967277 19:46536664-46536686 CAAGATCTCATCAGCCACATGGG - Intronic
1167368907 19:49069161-49069183 CGAGTTCCATAGGGCCACATCGG - Exonic
926603278 2:14869824-14869846 CAAGTCCACAATGGCCACAGAGG - Intergenic
927022922 2:19036049-19036071 CAAGTGCTCAATAGTCACATAGG + Intergenic
928328740 2:30340820-30340842 CAAATGCTCAATGGCCACTTGGG + Intergenic
928376941 2:30782954-30782976 CAAGTGCTCAATAGCCACACGGG + Intronic
928650141 2:33395391-33395413 CAAGTTTACAAGGTACACATAGG + Intronic
930082199 2:47460158-47460180 TAAATACTCAAGGGCCACACAGG - Intronic
930807791 2:55508752-55508774 CAAGCTCTCAAGAGCCACACTGG + Intergenic
936112838 2:109678834-109678856 CAAGGGCTCTACGGCCACATAGG - Intergenic
936572673 2:113629348-113629370 CAAGTACTCCAGGCCCACCTTGG + Intronic
937299355 2:120829753-120829775 CAGGATCTCAAGGCCCACATAGG - Intronic
937345110 2:121120670-121120692 CAAGTTCTTACAGGCCACAGAGG - Intergenic
937907631 2:127060019-127060041 CAAGTGCTCAATAGCCCCATGGG + Intronic
938636920 2:133238015-133238037 CAAGTTTTCATTGGCCACAGTGG - Intronic
938776366 2:134544845-134544867 CAAGTACCCAATGACCACATGGG + Intronic
941248772 2:163135311-163135333 CAAGCACTCAAGGGCCATTTGGG + Intergenic
941483351 2:166045952-166045974 CTGGTTCTTAAGGGGCACATGGG + Intronic
941658158 2:168166725-168166747 CAAGTGCTTAAGAGTCACATGGG + Intronic
942115500 2:172725592-172725614 CATGTTCTCTAGGGCCAGAAAGG - Intergenic
942397175 2:175562908-175562930 CAAGTTTTAAAAGACCACATAGG - Intergenic
943115425 2:183664002-183664024 CAAATGCTCAATAGCCACATGGG + Intergenic
943322394 2:186461698-186461720 CAAGTGCTCAATGGCCACAGGGG - Intergenic
945407054 2:209461314-209461336 CAAGTGCTCCAGAGACACATGGG + Intronic
945433384 2:209791926-209791948 CAAGTGTTCAATAGCCACATGGG - Intronic
946208249 2:218126424-218126446 CCAGTTCTCAGGGGCCTCAGAGG - Intronic
948112376 2:235466472-235466494 CAAGTGCTCAAGAGCCACATGGG + Intergenic
948172284 2:235914454-235914476 TAAGTGCTGAAGGGCCATATGGG + Intronic
948774199 2:240273641-240273663 AAAGGGCTCAAGGGCTACATAGG + Intergenic
1169325673 20:4673588-4673610 CAAGCCATGAAGGGCCACATGGG + Intergenic
1170713452 20:18812212-18812234 CAAGTGATCAAGGACAACATCGG + Intronic
1170830200 20:19833130-19833152 CACGTTGTCAGGGGCCACACAGG - Intergenic
1171061974 20:21973680-21973702 CAAGTGCTCAGTGGTCACATGGG - Intergenic
1172586666 20:36090202-36090224 CAAGTGCTCAATAGCCACAGAGG + Intergenic
1173736323 20:45363988-45364010 TAGGTTCTCAGGTGCCACATCGG + Intronic
1173905933 20:46628767-46628789 CAGGTGCTCAACAGCCACATGGG + Intronic
1175119372 20:56706543-56706565 CAGGAGCTCCAGGGCCACATGGG + Intergenic
1175370182 20:58483067-58483089 CAAGACCTCAAGGCACACATAGG - Intronic
1179006988 21:37523821-37523843 CAAGTTGTCCACGGCCACTTTGG + Intergenic
1180135488 21:45859496-45859518 CAGGGTCCCAAGGGCCACCTTGG - Intronic
1180939085 22:19645125-19645147 TAGGTCCCCAAGGGCCACATGGG + Intergenic
1181881688 22:25985580-25985602 CAAGAGCTCAAAGGCCACACTGG - Intronic
1182670730 22:31993540-31993562 CAAGTGCTCAGTAGCCACATAGG - Intergenic
1182710568 22:32320378-32320400 CATGCTCACAAGGGCAACATAGG + Intergenic
1182886004 22:33774835-33774857 CAGGTGCTTAAGAGCCACATGGG + Intronic
1183660643 22:39219088-39219110 CAAGTTCCCAAGGGCAAAAATGG + Intergenic
1183831339 22:40419766-40419788 CAAGTTCTCAAGGGAGAGCTTGG + Intronic
1184398115 22:44257223-44257245 CATGCTCACAAGGGCAACATAGG + Intronic
1185427517 22:50781531-50781553 CAAGTACTCCAGGCCCACCTTGG - Intronic
949091171 3:31096-31118 CAAGCTCTCAAGAGCCAAAGTGG + Intergenic
949954924 3:9259745-9259767 TAAGTGCTCAATGGCCACCTGGG - Intronic
950035041 3:9879109-9879131 CAAATACTCAATAGCCACATGGG - Intronic
952817316 3:37456921-37456943 CAAGTACTCAGTAGCCACATGGG + Intronic
952945661 3:38476691-38476713 AAAGATCTCAAGGACCACCTGGG - Intronic
953138013 3:40200336-40200358 AAAGTCCTCTTGGGCCACATGGG + Intronic
953390022 3:42528438-42528460 TAAGTTCCCCAAGGCCACATAGG - Intronic
954242635 3:49305953-49305975 CAAGTTCTAAAGGGTCACTGAGG + Intronic
954243273 3:49310810-49310832 CAAGTTCTAGAGGCCCCCATAGG - Intronic
954419242 3:50409929-50409951 CAAGAACTCCAAGGCCACATGGG - Intronic
956272007 3:67458013-67458035 CAGATGCTTAAGGGCCACATAGG + Intronic
956614254 3:71155514-71155536 CAAGTGCTCAAGAGCCCCATGGG + Intronic
956813030 3:72883211-72883233 CAAGTGCTCCACAGCCACATGGG + Intergenic
956814207 3:72893186-72893208 CAAGGGCTCAAAGGCCACACTGG - Intronic
957031492 3:75247317-75247339 CAAGCTCTCAAGAGCCAAAGTGG + Intergenic
957624608 3:82642188-82642210 TAATTTGTCAAGGGCCACCTGGG + Intergenic
959425782 3:106186129-106186151 CAATTTTTCCACGGCCACATAGG + Intergenic
961906843 3:130271708-130271730 CAAATGCTCAACAGCCACATGGG + Intergenic
963209542 3:142673826-142673848 CAAGCTCTCAAGGTCCAAAGTGG + Intronic
970481809 4:16483719-16483741 CAGGTTCTCAACGGCCACGTGGG - Intergenic
970747932 4:19321861-19321883 AAACTTCTCAAGGGCAAAATTGG + Intergenic
971947792 4:33304102-33304124 CAAGTTTTCAATTGCCACTTAGG - Intergenic
974874468 4:67686208-67686230 CAAGTTCTCTATGGCCCCAAGGG - Intronic
976226209 4:82797556-82797578 CAGGTTCCCACTGGCCACATGGG + Intronic
978184186 4:105837442-105837464 CATGTGATGAAGGGCCACATGGG - Intronic
978210895 4:106133775-106133797 CAAGTGGCCAAGGCCCACATCGG - Intronic
978338712 4:107698432-107698454 CAAGTTTTCCAGGTCCACATGGG + Intronic
982677555 4:158393531-158393553 CAAGTGTTCAATGACCACATGGG + Intronic
988730018 5:33963020-33963042 CAAATGCTCAAAGGCCCCATAGG - Intronic
988973704 5:36494522-36494544 CAAGTGCTCAATAGCTACATTGG + Intergenic
989197862 5:38733569-38733591 CTAAGTCTCAAGGGGCACATGGG - Intergenic
989606181 5:43246403-43246425 CCACTTCTCAAGGGCCTCACCGG - Intronic
998670392 5:144347156-144347178 TACGTGCTCAATGGCCACATGGG - Intronic
999591917 5:153157619-153157641 CAAGATCTCGTAGGCCACATGGG + Intergenic
1000407708 5:160906370-160906392 CAAGTTCTCCTGGGCCAAAAAGG + Intergenic
1001651333 5:173318225-173318247 CAAGTTCACGAGGTCCACGTAGG + Exonic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003024724 6:2543935-2543957 CAAGTACTCAATAGCCACATGGG - Intergenic
1004191974 6:13471855-13471877 CAAGCACTCAAAGGCCACATGGG - Intronic
1004831374 6:19480260-19480282 ACAGTTCTGAAGGGCCACAGTGG - Intergenic
1005080271 6:21950193-21950215 CAAGATCTTAAGGGCCACCTGGG - Intergenic
1006267322 6:32936138-32936160 CAAGCTCTGAAAGGACACATGGG - Intronic
1008043399 6:46827086-46827108 CAAGCACTCAATAGCCACATAGG + Intronic
1009733526 6:67642904-67642926 CAAGTGCTCAAGAGCCACTGTGG - Intergenic
1010870111 6:81026464-81026486 CATCTTCTCAAGCCCCACATTGG + Intergenic
1013243628 6:108268379-108268401 CAACTTCTCAAGTGCCAGCTGGG + Intergenic
1013754881 6:113449610-113449632 CAAGTGCTCAATAGCCACGTGGG + Intergenic
1015071668 6:129101663-129101685 CAAGTACTCAGTAGCCACATGGG + Intronic
1017559812 6:155615110-155615132 CAAGCTGTCAAGAGGCACATGGG - Intergenic
1017695939 6:157016342-157016364 CAAGTGCTCAACAGCCACACTGG - Intronic
1018002803 6:159594628-159594650 CAAGTTGGCAGCGGCCACATGGG + Intergenic
1018304501 6:162441099-162441121 CAAGTTCTCAACAGCCAGCTAGG + Intronic
1020443657 7:8245794-8245816 TAAGTACTCAAGAGCCACACGGG + Intronic
1024929962 7:54659276-54659298 CCAGTTCCCAAGGGCCATATGGG + Intergenic
1027257972 7:76443318-76443340 CCAGTCCTCATGGGCAACATGGG + Intergenic
1031175984 7:118350852-118350874 CAAGTGCTCAGCAGCCACATGGG - Intergenic
1032081325 7:128859931-128859953 CAAGGTCTCCAGGGCCACCCAGG + Intergenic
1037277448 8:17196287-17196309 CAAGCGCTCAACAGCCACATGGG - Intronic
1037518485 8:19657565-19657587 CCATTTCTCAAGAGCCACAATGG + Intronic
1038204235 8:25449720-25449742 CAAGTGCTCAACTGCCACACTGG + Intronic
1039189511 8:34956653-34956675 CAAGGTCTCAAGGTCCCTATAGG + Intergenic
1039623090 8:39019203-39019225 AAAGTTCTCAAGAGCCTGATAGG - Intronic
1039668572 8:39566886-39566908 CAGGTGCTCAATAGCCACATAGG - Intergenic
1041223636 8:55676341-55676363 AAATCTCTCAAGGGCCTCATGGG - Intergenic
1047740376 8:127801791-127801813 CAAGTGCTCAATACCCACATAGG - Intergenic
1048379448 8:133852051-133852073 CAAGTGCTCAGTGACCACATGGG + Intergenic
1056483703 9:87032825-87032847 ACATTTCTCAAAGGCCACATAGG - Intergenic
1057139465 9:92717922-92717944 CAGGTTGGCAAGGGCCACCTCGG + Exonic
1188350438 X:29123749-29123771 CAAGTGCTCAACAGCCACATGGG - Intronic
1193480554 X:82022489-82022511 CAAGTTCTCAAGAGAAAGATTGG + Intergenic
1195620973 X:106954515-106954537 GAAGTTCTCTTGGGCCTCATAGG - Intronic
1195830111 X:109047654-109047676 CTAGTTCTCAAGAACAACATAGG - Intergenic
1196842242 X:119869673-119869695 CAAGTGCTCAATAGCCACCTGGG + Intergenic
1198103237 X:133439830-133439852 CAAGTCCTCAAGGGCCATAGGGG - Intergenic
1198471405 X:136950349-136950371 CAAGTGCTGAAGAGCCACATAGG + Intergenic
1199845959 X:151693533-151693555 CAAGTGCTCCAGGTCCACAGTGG + Intergenic