ID: 903510082

View in Genome Browser
Species Human (GRCh38)
Location 1:23868272-23868294
Sequence GGGTAGCGATGCGGGCTCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903510082_903510087 -10 Left 903510082 1:23868272-23868294 CCCCGGAGCCCGCATCGCTACCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 903510087 1:23868285-23868307 ATCGCTACCCCTCAGCGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 20
903510082_903510091 9 Left 903510082 1:23868272-23868294 CCCCGGAGCCCGCATCGCTACCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 903510091 1:23868304-23868326 GCGGCCCACTCTTAACGCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 17
903510082_903510094 18 Left 903510082 1:23868272-23868294 CCCCGGAGCCCGCATCGCTACCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 903510094 1:23868313-23868335 TCTTAACGCGCAGGTGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 25
903510082_903510095 19 Left 903510082 1:23868272-23868294 CCCCGGAGCCCGCATCGCTACCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 903510095 1:23868314-23868336 CTTAACGCGCAGGTGCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 21
903510082_903510096 22 Left 903510082 1:23868272-23868294 CCCCGGAGCCCGCATCGCTACCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 903510096 1:23868317-23868339 AACGCGCAGGTGCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903510082 Original CRISPR GGGTAGCGATGCGGGCTCCG GGG (reversed) Exonic
900100899 1:961567-961589 GGGCGGCGCTGGGGGCTCCGTGG + Intronic
900284059 1:1890892-1890914 GGGCCGCGCTGCGCGCTCCGCGG + Exonic
903008541 1:20314472-20314494 GGGCAGCGTTGGGAGCTCCGAGG - Exonic
903510082 1:23868272-23868294 GGGTAGCGATGCGGGCTCCGGGG - Exonic
903724340 1:25430120-25430142 GGGCAGCGCTGTGGGCCCCGCGG - Intronic
912516625 1:110220413-110220435 GGGTAGCAAGGCAGGCTCCCTGG + Intronic
916802328 1:168226474-168226496 GGGTAGGGCTGGGGGCCCCGAGG + Intronic
920333350 1:205228037-205228059 CGGGCGCGCTGCGGGCTCCGCGG + Intergenic
922480530 1:225937567-225937589 GGGCAGCGAGGCAGTCTCCGAGG + Exonic
1064560824 10:16594053-16594075 GCGCAGCGAAGCTGGCTCCGTGG + Intronic
1067112302 10:43409059-43409081 GGGTGGGGACGCGGGCTCCTTGG - Intronic
1072656583 10:97334348-97334370 GGGTGCCGCTGCGGGCCCCGGGG - Exonic
1088606955 11:111541362-111541384 GGGTAGGGATGCTGGATCCCCGG + Intronic
1091243248 11:134069250-134069272 GGATAGCGGTCCTGGCTCCGAGG + Intronic
1091915343 12:4269228-4269250 GGGTCGCGGCGCTGGCTCCGGGG + Intergenic
1092082116 12:5724792-5724814 AGGTAGGGATGGGGGCCCCGGGG + Intronic
1097196823 12:57247009-57247031 GGGTGGCGGTGGGGGCGCCGCGG + Intronic
1100639889 12:96472375-96472397 GGTTAGGGATGTGGGCTCCAGGG - Intergenic
1114060623 14:19013488-19013510 GGGTAGCACTGCGGGCTTCTTGG + Intergenic
1114101633 14:19386490-19386512 GGGTAGCACTGCGGGCTTCTTGG - Intergenic
1116821721 14:49633916-49633938 GGCTGGGGCTGCGGGCTCCGGGG - Exonic
1119662649 14:76462811-76462833 GGAGAGCCATGCGGGCGCCGTGG - Intronic
1125507460 15:40275025-40275047 GGTTAGCGGTGCGGGCTCCAAGG - Intronic
1136224060 16:28846764-28846786 GCGTAGCGAGTCGGACTCCGGGG - Exonic
1136478446 16:30526951-30526973 CGGTAGCCCCGCGGGCTCCGGGG - Intronic
1137707405 16:50545191-50545213 GGGTGGCCATTCGGCCTCCGAGG - Intergenic
1143247787 17:5500738-5500760 GGGGCGCGATGCGGCCTTCGGGG + Intronic
1144756206 17:17681921-17681943 GGGTGGAGATGTGGGGTCCGCGG + Intronic
1145903754 17:28505460-28505482 GGGTGGAGATGGGGGCTCCCTGG - Intronic
1147951318 17:44109497-44109519 GGGTATCCATGCAGGCCCCGAGG - Intronic
1152814482 17:82399349-82399371 GGGCAGCGAGGCTGGCACCGGGG - Intronic
1161364169 19:3868758-3868780 CGGGCGGGATGCGGGCTCCGGGG - Intronic
1161739590 19:6012572-6012594 GGGGGGTGATGCTGGCTCCGCGG + Intronic
1162100065 19:8334022-8334044 GGGTAGCTCCTCGGGCTCCGGGG - Exonic
1163343929 19:16727684-16727706 GGGTATGGATGGGGGCTCAGAGG + Intronic
1166529736 19:43535124-43535146 GGGCAGCGGTGCGGGCGCTGGGG - Exonic
927849223 2:26488524-26488546 GGGCAGCCATGTGTGCTCCGTGG - Intronic
929127648 2:38535962-38535984 AGGTGGAGCTGCGGGCTCCGAGG + Intergenic
936268377 2:111028944-111028966 GGTTAGGGATGTGGGCTCAGAGG + Intronic
942653831 2:178194715-178194737 GGGCCGCGATGCGGGCACCTTGG - Intronic
947535566 2:230938745-230938767 GGGCAGCCATGTGGGCTCCGTGG + Intronic
1175716023 20:61254172-61254194 GGCTGGAGATGGGGGCTCCGAGG + Intronic
1179177092 21:39016085-39016107 GCGTAGAGCTGCGGGCTCCTGGG + Intergenic
1180109780 21:45642603-45642625 GCACAGCGAGGCGGGCTCCGCGG + Intergenic
1183328975 22:37209255-37209277 GGGTAGCCAGGCGTGCTCAGAGG - Intronic
1184050255 22:41998851-41998873 CGTTAGGGATGAGGGCTCCGCGG - Exonic
949559314 3:5187711-5187733 GGGAAGCGAGCCGGGCTACGGGG + Exonic
950339874 3:12233812-12233834 GGGCAGCGATGGGAGCTCCGTGG - Intergenic
957200777 3:77133268-77133290 GGGTAGCGATGAGGCCACTGGGG + Intronic
973532192 4:51844441-51844463 GGGCAGGGGTGCGGGCTGCGGGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
979584785 4:122403397-122403419 GGGTAGCGAAGTGGACTCTGTGG + Intronic
985502014 5:254214-254236 GGCCAGCCATGCGGCCTCCGTGG + Intronic
985735003 5:1574452-1574474 GGCCAGCCATGCGGCCTCCGTGG - Intergenic
997521155 5:134525445-134525467 AGGTAGCGTTGCGGGCCCCGTGG - Intronic
998426487 5:142033277-142033299 GGGTAAAGATGCGGGCTCCTTGG + Intergenic
1033339183 7:140478941-140478963 GGACAGCGCTGAGGGCTCCGCGG + Intronic
1042829321 8:73009241-73009263 GGGGGCGGATGCGGGCTCCGTGG + Intronic
1049401396 8:142429103-142429125 TGGGAGGGATGCGGTCTCCGTGG - Intergenic
1049623552 8:143609926-143609948 GGGTAGCGAAGCGGGTTGCGGGG + Intergenic
1049643470 8:143725875-143725897 GGGCAGCGATGCGGGCACCCTGG + Exonic
1061178091 9:129009301-129009323 GGGTGGGGAGGCGGGCTCTGTGG + Exonic
1185836193 X:3347196-3347218 GGGGAGGGAGGCGGGCGCCGGGG - Intergenic
1189324557 X:40104958-40104980 GGGCGGAGGTGCGGGCTCCGCGG + Intronic
1200003258 X:153072699-153072721 GGGCAGCGGTCCGGGGTCCGGGG + Intronic
1200004465 X:153077310-153077332 GGGCAGCGGTCCGGGGTCCGGGG - Intergenic