ID: 903510130

View in Genome Browser
Species Human (GRCh38)
Location 1:23868449-23868471
Sequence CTCAAGAAGGGAAAGACGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903510118_903510130 20 Left 903510118 1:23868406-23868428 CCCGAGTCGCTTCCTCCTCGGGT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 903510130 1:23868449-23868471 CTCAAGAAGGGAAAGACGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 213
903510122_903510130 8 Left 903510122 1:23868418-23868440 CCTCCTCGGGTCGGAGGAGCGCC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 903510130 1:23868449-23868471 CTCAAGAAGGGAAAGACGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 213
903510119_903510130 19 Left 903510119 1:23868407-23868429 CCGAGTCGCTTCCTCCTCGGGTC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 903510130 1:23868449-23868471 CTCAAGAAGGGAAAGACGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 213
903510123_903510130 5 Left 903510123 1:23868421-23868443 CCTCGGGTCGGAGGAGCGCCCTC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 903510130 1:23868449-23868471 CTCAAGAAGGGAAAGACGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903510130 Original CRISPR CTCAAGAAGGGAAAGACGCA GGG Intergenic
900968379 1:5975466-5975488 CTGAAGAAGGGAATGCAGCAAGG - Intronic
903510130 1:23868449-23868471 CTCAAGAAGGGAAAGACGCAGGG + Intergenic
904462042 1:30686015-30686037 CCCAACAATGGAAAGACCCAGGG + Intergenic
904782825 1:32963945-32963967 CCCAAGCAGGGAAACCCGCAAGG - Intronic
906276525 1:44520591-44520613 TTTAAGATGGGCAAGACGCAGGG - Intronic
906604921 1:47161859-47161881 CTCAAGGCGGGAAAGAGTCAAGG + Intergenic
907284984 1:53373941-53373963 TTCCAGAAAGGAAAGACCCATGG - Intergenic
915004917 1:152626953-152626975 CCTAAGAAGGGACAGACACATGG - Intergenic
916928745 1:169551555-169551577 TGGAAGAAGGGAAAGAGGCATGG + Intronic
917713290 1:177709232-177709254 CTCAGTAAGGGGCAGACGCAAGG - Intergenic
917795895 1:178532529-178532551 CTCCAGAAGGAAAAGCGGCAAGG + Intronic
920209648 1:204319020-204319042 ATCAAGATGGGAAGGAAGCAAGG - Intronic
923037702 1:230296220-230296242 CTCAAAAAGAGAAAGACAGAGGG + Intergenic
924052152 1:240090166-240090188 CAAAAGAAGGGAAAGAAGGAGGG - Intronic
924205481 1:241707332-241707354 CTCCAAAAGGGAAATACTCAAGG - Intronic
924532358 1:244904174-244904196 CTCAAGAAAGGAAGGAAGGAAGG + Intergenic
1063096668 10:2915005-2915027 CTCAAGAAGGAAAGGAAGCATGG + Intergenic
1064367156 10:14718332-14718354 CTCAAGAAAGGAAGGAAGGAAGG + Intronic
1064460353 10:15529091-15529113 CTCAAGAAAGGAAGGAAGAAGGG - Intronic
1072860911 10:99005251-99005273 TTCAAGAAGAGAAAGACAAATGG - Intronic
1073481154 10:103786904-103786926 CTCAGGAAGGGCAAGAAGGAAGG - Intronic
1073635233 10:105191298-105191320 CTGAGGAAGGAAAAGAAGCAAGG + Intronic
1075111979 10:119595781-119595803 TCCAAGAAGGGAAAGATGCTCGG + Intronic
1075288685 10:121209459-121209481 ATTAAGAAGGAAAAGAGGCAAGG + Intergenic
1075846935 10:125552357-125552379 CCCAAGAAAGGAATGAAGCACGG - Intergenic
1075970935 10:126651782-126651804 CCCAAGAAGGCAAAGACCAAAGG + Intronic
1077731034 11:4730134-4730156 CCCAATAAGGGAAAGACCAATGG - Intronic
1078197876 11:9151667-9151689 CCCAAGAAGTAAAAGAAGCAGGG + Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1079151312 11:17902130-17902152 CTGAAGAAGGGAGAGAGGGATGG + Intronic
1079346031 11:19653065-19653087 CTCAAGAAGGGAATGGAGAAAGG - Intronic
1081458310 11:43247111-43247133 ATCAAGAAGGGAAGGAGGCATGG + Intergenic
1083145112 11:60752357-60752379 CTGAGGAAGGGAAAGACCGATGG + Intergenic
1083875935 11:65524674-65524696 CTTAAGAAGGGACAGAGGGATGG - Intergenic
1085441036 11:76562434-76562456 CAGAAGATGGGAAAGAAGCAGGG + Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089418191 11:118310974-118310996 CTCAAGAAGGAAAGGAGGAAAGG + Intronic
1089462013 11:118659093-118659115 CCCAAGGAGGGAAAGAGGCCTGG + Intronic
1089793039 11:120958139-120958161 CTCCAGAAGGAAAAGCCCCAGGG - Intronic
1090474810 11:127010386-127010408 CTCAAGAAAGGAAGGACCAAGGG - Intergenic
1090944852 11:131420662-131420684 CTGCAGAAGGGAAAGAGCCAGGG - Intronic
1090973700 11:131664239-131664261 CTCAACATGGGACAGAAGCATGG + Intronic
1091541677 12:1468192-1468214 AGCAAGAAGGTAAAGACTCATGG + Intronic
1092016231 12:5161141-5161163 CTCCAGAAAGGAAAAACGGAAGG + Intergenic
1094778260 12:33757916-33757938 ATCAAAAAGGGAAAAACACAAGG - Intergenic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1099646682 12:85366587-85366609 TTCAAGAAGGGAAAGTGGCTGGG - Intergenic
1099748090 12:86733357-86733379 CTTAAGAAGGGGAAGGCACAAGG + Intronic
1100970211 12:100061781-100061803 ATCACGAAGGGAAAGAAGCAGGG + Intronic
1101265895 12:103086960-103086982 CTCAACAAGTGAAAAACCCAAGG + Intergenic
1104706175 12:130949145-130949167 CACAAGTAGGGAAAGTGGCAGGG - Intergenic
1105014296 12:132776757-132776779 CTAAAGAGGGGAAAGTCACATGG + Intronic
1106562209 13:30856731-30856753 CACAAGAAGGGAGAGAAGGAGGG - Intergenic
1107820462 13:44281244-44281266 CACAAGAAGGGGAAACCGCAGGG + Intergenic
1109691732 13:65902144-65902166 CTCAAGAAGAGAAAGATACAGGG - Intergenic
1111290239 13:86157058-86157080 CTCAACAAGGGAAACACATAGGG + Intergenic
1115401831 14:32970589-32970611 CTCCAGAATGAAAAGACGTAAGG - Intronic
1116954136 14:50906699-50906721 CGCAAGAATGCAAAGACACAGGG - Intronic
1116993518 14:51299918-51299940 TTGTAGAAGGGAAAGACACAAGG - Intergenic
1117219727 14:53591041-53591063 CTTAAGAAGTGGAAGAGGCAAGG + Intergenic
1117862133 14:60103558-60103580 CTCAAGAAGCCTAAGAAGCATGG - Intronic
1118926230 14:70192186-70192208 CTTAAGATGGGAGAGAAGCAGGG - Intergenic
1120074107 14:80136187-80136209 CTAAAGAAGGGAATGAATCAAGG - Intergenic
1121768217 14:96505905-96505927 GTCAAGAACGGAAGGAAGCAAGG - Intronic
1122536886 14:102471245-102471267 CTCAAGAAGAAAGAGAGGCAGGG - Intronic
1122981443 14:105193981-105194003 CTCCAGAAGGGAAAGATGTTGGG - Intergenic
1125414585 15:39439003-39439025 CTCAAGTGGGGAAAGAAGGAAGG + Intergenic
1126782839 15:52153175-52153197 CACAAGAAGGGGCAGAGGCAGGG - Intronic
1126783904 15:52161296-52161318 CTCAAAAAAAGAAAGAGGCATGG - Intronic
1126802156 15:52308800-52308822 CTCTAGAAGGGAAGGGAGCAAGG + Exonic
1130033354 15:80335462-80335484 ACCATGAAGGGAAAGAGGCAGGG + Intergenic
1130512171 15:84599036-84599058 CACAAAAAGGAAAAGATGCAGGG - Intergenic
1131301314 15:91202063-91202085 GTAAAGAAGAGAAAGAAGCAGGG - Intronic
1131568958 15:93513284-93513306 CTCAACAAGGGAGAGTCACAGGG + Intergenic
1131857759 15:96616873-96616895 ATCCAGAAGGGAAAGAAGCCAGG - Intergenic
1132312646 15:100868445-100868467 CTCAAGAAGGAAAACACTCTTGG - Intergenic
1132517503 16:372627-372649 ATCACGAAGGCAAAGAGGCAGGG + Exonic
1134363058 16:13550777-13550799 ATCAAGTTGGGAAAGAAGCAGGG - Intergenic
1134563184 16:15228315-15228337 CTCAATAAGGCAAACAAGCAAGG - Intergenic
1134923715 16:18139944-18139966 CTCAATAAGGCAAACAAGCAAGG - Intergenic
1135352472 16:21740698-21740720 CTGAAGAAAGGAGAGATGCAGGG - Intronic
1135450960 16:22556820-22556842 CTGAAGAAAGGAGAGATGCAGGG - Intergenic
1136479185 16:30531080-30531102 CTAAAGACAGGAAAGATGCAAGG + Intronic
1138794054 16:59946138-59946160 CTGAAGAAGTGACAGAGGCAAGG - Intergenic
1140033123 16:71354249-71354271 CTCAAGAAGGGAGGGAGGCTTGG - Intergenic
1141734979 16:85846342-85846364 CAAAGGAAGGGAAAGACCCAGGG - Intergenic
1141793793 16:86255259-86255281 CTTAAGAAGGGAAAGAAGAATGG - Intergenic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1142641984 17:1289566-1289588 CACAAGATGGGAAAGAAGGAGGG - Intronic
1142953506 17:3504228-3504250 CTCAAGATGGGATAGAAGGAGGG - Intronic
1143175896 17:4955007-4955029 CTCAAGAAGGGACAGGGGCGGGG - Intronic
1143347411 17:6260078-6260100 CTCAGCAAGGGGAAGACCCAAGG + Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144275416 17:13663559-13663581 TTGAAGAAGGAAAAGACACAGGG + Intergenic
1144631168 17:16873241-16873263 CTCAGGAAGGTAAAGAAGCCGGG + Intergenic
1144650118 17:17002096-17002118 CTCAGGAAGGTAAAGAAGCCGGG - Intergenic
1145074299 17:19838730-19838752 CTAAAGAAGGGAAAAAAGCCGGG + Intronic
1149873704 17:60207824-60207846 TTGAAGAAGGGAAATACGTAAGG - Intronic
1150794749 17:68228486-68228508 CTCAGGAAGGGACAGAAGGATGG - Intergenic
1151814308 17:76463724-76463746 CACAAGAAGGGAAGAACCCAGGG - Intronic
1155176387 18:23304900-23304922 CTGAAGAAGGGAGAGAGGCCAGG - Intronic
1155799635 18:30084698-30084720 CTCTAGAAGGGAGAAACGTAAGG - Intergenic
1156204674 18:34872784-34872806 CTGAAGAGGGAAAAGACACAGGG - Intronic
1156542700 18:37930806-37930828 CTCAACAAGGAAATGACACATGG - Intergenic
1156700458 18:39818705-39818727 TTCAAAAAGGGAAAGAGTCATGG + Intergenic
1156865593 18:41885746-41885768 CTTAAGAAGGTAAAAACACATGG - Intergenic
1157642997 18:49236622-49236644 TTCAGGAAGGGAAATAGGCAGGG + Intronic
1162231566 19:9270949-9270971 CACCAGAAGGGAAAGAGGCCAGG - Intergenic
1164681834 19:30139699-30139721 CCCAGGAAGGGAAAGAAGGAAGG + Intergenic
1166282178 19:41801360-41801382 CTCAAGAAGGGAAAGAGCCCTGG - Intronic
1167842432 19:52132913-52132935 CTCAATGTGGGAAAGACTCATGG - Intronic
926216368 2:10908024-10908046 CAGAAGATGGGAGAGACGCATGG - Intergenic
929059431 2:37907971-37907993 CTCAAGAATGAAAAAATGCATGG + Intergenic
929984775 2:46717314-46717336 CTAAAGAAGGAAAACAAGCAAGG - Intronic
931268862 2:60684312-60684334 CTCAAGAAAGGAAGGAAGGAAGG + Intergenic
933289967 2:80426935-80426957 GTCATGAAGTGAAAGACGTAAGG - Intronic
935571429 2:104664970-104664992 CACAGGAAGAGAAAGAGGCAGGG + Intergenic
937604816 2:123786562-123786584 CTCAAGGATGCAAGGACGCAAGG - Intergenic
937936598 2:127250334-127250356 CTGGAGAAGGGAAAGAAACAGGG - Intergenic
939884481 2:147666110-147666132 TTCAAGAAGGGAAAGGGGCCGGG + Intergenic
939900660 2:147845392-147845414 CTCAAAAAGAGAAAAATGCATGG - Intronic
940009362 2:149038454-149038476 CTCAGGAAGTGAAAGAAGCACGG - Exonic
941391825 2:164924325-164924347 CTAAAGAATGGAAAGAAGGAGGG + Intronic
941753664 2:169161819-169161841 ATCAAGAAGGGAACGCCACAGGG - Intronic
942092807 2:172510269-172510291 CTTAAAAAGGGAAGGAAGCATGG + Intergenic
942567474 2:177281205-177281227 CTAAAGAAGGGAAGGATGCCGGG - Intronic
942965317 2:181885609-181885631 CTCATGAATGGAAAGAAACATGG - Intergenic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
1168959524 20:1859350-1859372 CTAAAGATGGCAAAGACGAATGG + Intergenic
1171779957 20:29409709-29409731 CTCTGGAAGGGAAAGAGGGAGGG - Intergenic
1172114761 20:32567133-32567155 CTCAGGAGGGGAAGGAGGCAAGG - Intronic
1172131821 20:32661055-32661077 ATCAAGGAGGGAAAGAGGAAGGG + Intergenic
1174849022 20:53973787-53973809 CTCAAGAAAGAAAAGAAGGAAGG + Intronic
1175885104 20:62285765-62285787 CTCCCGAAGGGAAACACGCCTGG + Intronic
1176037156 20:63045186-63045208 CTGCTGAAGGGAAAGACCCAGGG - Intergenic
1178676379 21:34634906-34634928 CTCAAGAAAGGAAGGAAGGAAGG + Intergenic
1180745861 22:18088461-18088483 CTCAAGAAGTGAAAGGCCAAGGG - Exonic
1180863927 22:19105024-19105046 CTCAAGAAGGGACAGAGGGCCGG + Intronic
1183227761 22:36562081-36562103 GCAAAGAGGGGAAAGACGCAGGG - Intergenic
1184817226 22:46881484-46881506 CTCAGTAAGGGACAGACACAGGG - Intronic
1184893646 22:47394394-47394416 CTCCAGCAGGGAAGGACACAGGG + Intergenic
1184966599 22:47978424-47978446 CTCAAGAAGCTAAAAAAGCAAGG - Intergenic
949660941 3:6277657-6277679 CACAAGAAGGAAAATATGCAAGG + Intergenic
952150437 3:30583540-30583562 CCCAAGAAGGGAAAAAAGGAAGG - Intergenic
954654184 3:52183958-52183980 CACAAGAAGGGGAAGAGGGAGGG + Intergenic
960281353 3:115784393-115784415 GTCGAGAAGGGAGAGAGGCAGGG - Intergenic
961345750 3:126262233-126262255 CTCTAGAAGGGAAAAAGGGAAGG + Intergenic
961746067 3:129064212-129064234 CTCAAGAAGGCACTGAAGCAGGG - Intergenic
962434225 3:135349615-135349637 CTCAAAAAAGGACAGAGGCATGG + Intergenic
964102796 3:153007013-153007035 CTCAAGAAGGAAGAGACGCTGGG + Intergenic
964793320 3:160472949-160472971 CTCAAGAATGGAAAGAGACCTGG + Intronic
964873042 3:161334407-161334429 CTAAAGAAGGGAAGGAAGGAGGG - Intergenic
967216938 3:187218990-187219012 CCCAAGAAGGGAAGGAGGCCAGG + Intronic
967783859 3:193468744-193468766 CTCAAAAAAGGAAAGAAACAAGG + Intronic
970113059 4:12660438-12660460 ATCAAGAAAGGAAAGAAGGAAGG + Intergenic
970503082 4:16697798-16697820 CTCCAGTAGGGAAAGACTGATGG + Intronic
971207330 4:24583833-24583855 CTCCAGACGGGAAAGGCGGAGGG - Intronic
976522127 4:86040523-86040545 TTCAAGAAGAGAAAGACAAAGGG + Intronic
977710129 4:100115120-100115142 GTCAAGAAGGTCAAGAAGCAGGG - Intergenic
978789742 4:112648688-112648710 CTCCAGAAGGGTAAAAGGCAGGG + Intronic
980889795 4:138802376-138802398 CTCACTAAGGGAAAGAAGCATGG + Intergenic
981439189 4:144763227-144763249 ATAAAGAAAGGAAAGACACATGG + Intergenic
981820877 4:148886286-148886308 CTGAAGAGAGGAAAAACGCAGGG + Intergenic
983848133 4:172544231-172544253 GACAGGAAGGGAAAGAGGCAAGG - Intronic
985094471 4:186399974-186399996 CTAGAGCAGGGAAATACGCAGGG - Intergenic
986185260 5:5429772-5429794 CCCAAGAAAGGAAGGAAGCATGG + Intronic
987097278 5:14561058-14561080 CTCAAAAAAGAAAAGAAGCAGGG + Intergenic
988249432 5:28736512-28736534 CTCAAAAAGGGAAATAGGCAAGG + Intergenic
989643898 5:43608222-43608244 TTCAAGAATGGAAAGAAGCCAGG - Intronic
993335326 5:86650865-86650887 ATCAAGATGGGAAAAATGCATGG - Intergenic
999471724 5:151860557-151860579 CTCAAGAAGTGAAGGAGGGATGG + Intronic
1000101579 5:158022098-158022120 CTCAAGAAAGGCAAGAAACAAGG - Intergenic
1000608283 5:163347977-163347999 CTCTAGAAGGGCAAGAAGTAGGG + Intergenic
1002902055 6:1417487-1417509 CCCAAGAAGGCAGAGACGCCGGG - Intergenic
1003504652 6:6730099-6730121 CCCATGAAGGGAAATACCCAAGG + Intergenic
1005273100 6:24187195-24187217 CTCAACAATGGAAAGAGGGATGG + Intronic
1006102310 6:31693150-31693172 CTGAGGAAGGGAAAGATGCAGGG + Intronic
1006375251 6:33668337-33668359 CCCAAGGAGGGAAAGCCCCAGGG - Intronic
1007698768 6:43751649-43751671 CTCAAGAAGAAACAGAGGCAGGG + Intergenic
1009288935 6:61860235-61860257 CACAAGAAGAGATAGACTCATGG + Intronic
1012892881 6:104917131-104917153 CTAAAGCAGGGAAAGAGGGAGGG - Intergenic
1013577245 6:111496123-111496145 CTCAAGAATGAAAAAACTCAAGG - Intergenic
1014180323 6:118377311-118377333 CTCAAGAAAGGAAAGAATCAGGG + Intergenic
1015225841 6:130855953-130855975 CTGGAGCAGGGATAGACGCATGG + Intronic
1016757210 6:147699790-147699812 CTCAAGATGAGCAAGACTCAGGG + Intronic
1017399884 6:154047952-154047974 CTCCACAAGGCAAAGAGGCAAGG + Intronic
1019742465 7:2681702-2681724 CTCCAGCAGGAAAAGACACACGG - Intronic
1022830098 7:34057112-34057134 GTCAGGAAGGGAAAGAGGCAGGG + Intronic
1022841228 7:34165783-34165805 TTCAGGAAGGGAAAGAGGAAAGG + Intergenic
1023387761 7:39677161-39677183 CTCTAGAAGCGAAAGAGGCAAGG + Intronic
1024347839 7:48330905-48330927 ATCAGGAAGGGAAAAACCCACGG - Intronic
1027531981 7:79346389-79346411 AACAAGAAGGGAAAAACTCATGG - Intronic
1027912484 7:84269017-84269039 ATGAAGAAAGGAAAGAAGCAAGG - Intronic
1029573723 7:101388989-101389011 CCCAAGAAGGGGAAGCCCCATGG - Intronic
1029957506 7:104655018-104655040 AGGAAGAAGGGAAAGAGGCAGGG - Intronic
1032170375 7:129579353-129579375 CACAAGAAGGGAAAGAAAAAGGG - Intergenic
1032975443 7:137217385-137217407 CCCAAGAATGCAAAGACACACGG + Intergenic
1033251035 7:139759745-139759767 CTCTAAAAATGAAAGACGCAAGG + Intronic
1034437746 7:151071222-151071244 CTCAAGAAGCGAGAGGAGCAGGG + Exonic
1036020465 8:4839154-4839176 CTGATGAAGGGAAAGAAGGATGG - Intronic
1037784241 8:21893097-21893119 ATCAGGAAGGGAAAGAGGCCAGG + Intergenic
1038692425 8:29775330-29775352 CTCAAGATGGGAAAGTCAAAGGG + Intergenic
1039227228 8:35401481-35401503 CTCAAAAAGGGAAGGAAGCTGGG + Intronic
1039753809 8:40500939-40500961 CTCAAGAAGGGAAACATGAAGGG - Intergenic
1044019893 8:87093196-87093218 CCCACGAATGGAAAGACTCAGGG - Intronic
1045003487 8:97898061-97898083 CTGAAGAAGGGAATGAGGAAGGG - Intronic
1045272550 8:100674414-100674436 CTCAAGGAAGGAAAGAAGGAAGG - Intergenic
1045335293 8:101196885-101196907 CTCAAAAAGGGAAAGACTGCAGG + Intronic
1046885920 8:119366929-119366951 CTTGAGAAGGGAATGAGGCAGGG - Intergenic
1047140074 8:122128501-122128523 CTGTAGAAGGAAAAGATGCAAGG + Intergenic
1048295812 8:133212580-133212602 CTCAAGAAAGGAAAGGAGCAGGG + Intronic
1050879692 9:10683733-10683755 GTCAAGAAGGTAAAGAGGCCAGG + Intergenic
1053670641 9:40358514-40358536 CTGAAGATGGGATACACGCAGGG + Intergenic
1053920433 9:42984865-42984887 CTGAAGATGGGATACACGCAGGG + Intergenic
1054513972 9:66017786-66017808 CTGAAGATGGGATACACGCAGGG - Intergenic
1058469994 9:105268007-105268029 CTCAAGCAGGGAAAGAAGGTTGG + Intronic
1059682191 9:116597012-116597034 CTCAAGAAGGGAAAGAGTTTGGG + Intronic
1061670348 9:132184993-132185015 CTTAAGAAGGGGAAGGCGCTGGG + Intronic
1203486463 Un_GL000224v1:60366-60388 CTCAAGGAGGTAAAAACGCCAGG - Intergenic
1203499084 Un_KI270741v1:2265-2287 CTCAAGGAGGTAAAAACGCCAGG - Intergenic
1188136653 X:26501004-26501026 CTCAAGTAGGGAAAAACAAATGG - Intergenic
1190287069 X:48968756-48968778 CTCAAAAAGAGAAAGAGGCCAGG + Intronic
1190707661 X:53044050-53044072 CACAAGGAGGGTAAGAGGCATGG + Intergenic
1192222183 X:69204864-69204886 CTCAAAAAAGGAAGGAAGCAAGG - Intergenic
1194664986 X:96667442-96667464 CTAAAGAAAAGAAAGACGCTGGG + Intergenic
1195982946 X:110599594-110599616 CTAAAGAAGTGAAAGAGGCTGGG - Intergenic
1199785606 X:151102406-151102428 CTACAGAAGGCAAAGAGGCATGG + Intergenic
1199839666 X:151631846-151631868 CTCAAGATGGGACAGACATAAGG - Intronic
1200038842 X:153351095-153351117 CTGAAGATGGGAAAGAGTCAAGG - Exonic
1201565390 Y:15360105-15360127 CTTTATAAGGGAAAGAAGCAAGG - Intergenic